\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0820422849:

Variant ID: vg0820422849 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 20422849
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGACCTCACGAAACTTTTTATTTTAGCAATGGAAAAAATGCAATACTTTGAGAAAAGAAATAGAAAGTTAGCAGCATCAGAGCAGGACACAATGAATG[A/C]
GTTATAATATCTAGCATGCATTGCTAATGTTATTTCACATACGGACTATCACATATTAGCACAAATAATTTTAAGTCTCTTATCCAACTTTTTTAATCGT

Reverse complement sequence

ACGATTAAAAAAGTTGGATAAGAGACTTAAAATTATTTGTGCTAATATGTGATAGTCCGTATGTGAAATAACATTAGCAATGCATGCTAGATATTATAAC[T/G]
CATTCATTGTGTCCTGCTCTGATGCTGCTAACTTTCTATTTCTTTTCTCAAAGTATTGCATTTTTTCCATTGCTAAAATAAAAAGTTTCGTGAGGTCCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 4.00% 0.34% 0.00% NA
All Indica  2759 93.50% 6.30% 0.25% 0.00% NA
All Japonica  1512 99.50% 0.10% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 89.50% 10.30% 0.22% 0.00% NA
Indica III  913 92.00% 7.80% 0.22% 0.00% NA
Indica Intermediate  786 92.60% 6.90% 0.51% 0.00% NA
Temperate Japonica  767 99.30% 0.00% 0.65% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 11.50% 1.04% 0.00% NA
Intermediate  90 92.20% 4.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0820422849 A -> C LOC_Os08g32930.1 upstream_gene_variant ; 890.0bp to feature; MODIFIER silent_mutation Average:21.218; most accessible tissue: Minghui63 root, score: 33.152 N N N N
vg0820422849 A -> C LOC_Os08g32930.2 upstream_gene_variant ; 885.0bp to feature; MODIFIER silent_mutation Average:21.218; most accessible tissue: Minghui63 root, score: 33.152 N N N N
vg0820422849 A -> C LOC_Os08g32920.1 downstream_gene_variant ; 4122.0bp to feature; MODIFIER silent_mutation Average:21.218; most accessible tissue: Minghui63 root, score: 33.152 N N N N
vg0820422849 A -> C LOC_Os08g32920-LOC_Os08g32930 intergenic_region ; MODIFIER silent_mutation Average:21.218; most accessible tissue: Minghui63 root, score: 33.152 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0820422849 NA 3.64E-07 mr1145 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 3.93E-06 4.04E-06 mr1214 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 1.08E-06 mr1382 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 3.52E-08 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 6.03E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 5.39E-06 mr1227_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 3.20E-08 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 5.42E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 3.79E-07 3.79E-07 mr1356_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 1.87E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 2.58E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 4.39E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 3.89E-06 mr1541_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 9.41E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 3.69E-07 9.36E-09 mr1622_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 5.90E-06 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 6.89E-07 2.58E-07 mr1676_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 5.12E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 4.57E-06 1.35E-07 mr1862_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 8.44E-06 mr1866_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0820422849 NA 2.04E-06 mr1956_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251