| Variant ID: vg0819137940 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 19137940 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, T: 0.43, others allele: 0.00, population size: 68. )
CAGACCGTCGGTTGAGGGCCGGTCAGACCGTCGGTTGAGGGCCGGTCAGACCGACGGTGTGTGGCCGGTCTGACCGGCAGGTCCGAGTCCGACTGCGTTT[C/T]
GTCGGGTTTCATGGTTTCCTTGCTCGGGAAGGCATGTTTCGGGTTTCCTTTAGTTTCTACCCCGAGTTGGATGTGGAGGAGGGCCTGTAGAGGACAAGAC
GTCTTGTCCTCTACAGGCCCTCCTCCACATCCAACTCGGGGTAGAAACTAAAGGAAACCCGAAACATGCCTTCCCGAGCAAGGAAACCATGAAACCCGAC[G/A]
AAACGCAGTCGGACTCGGACCTGCCGGTCAGACCGGCCACACACCGTCGGTCTGACCGGCCCTCAACCGACGGTCTGACCGGCCCTCAACCGACGGTCTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.00% | 8.90% | 25.12% | 32.99% | NA |
| All Indica | 2759 | 3.60% | 10.40% | 33.16% | 52.92% | NA |
| All Japonica | 1512 | 86.60% | 0.40% | 9.06% | 3.97% | NA |
| Aus | 269 | 7.10% | 45.00% | 42.38% | 5.58% | NA |
| Indica I | 595 | 3.50% | 8.40% | 33.11% | 54.96% | NA |
| Indica II | 465 | 1.90% | 10.50% | 30.75% | 56.77% | NA |
| Indica III | 913 | 4.40% | 11.20% | 36.47% | 47.97% | NA |
| Indica Intermediate | 786 | 3.60% | 10.80% | 30.79% | 54.83% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.26% | 0.65% | NA |
| Tropical Japonica | 504 | 65.30% | 1.20% | 24.40% | 9.13% | NA |
| Japonica Intermediate | 241 | 91.30% | 0.00% | 4.98% | 3.73% | NA |
| VI/Aromatic | 96 | 90.60% | 2.10% | 6.25% | 1.04% | NA |
| Intermediate | 90 | 52.20% | 5.60% | 16.67% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0819137940 | C -> T | LOC_Os08g31000.1 | upstream_gene_variant ; 1669.0bp to feature; MODIFIER | silent_mutation | Average:60.698; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0819137940 | C -> T | LOC_Os08g30990.1 | downstream_gene_variant ; 309.0bp to feature; MODIFIER | silent_mutation | Average:60.698; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0819137940 | C -> T | LOC_Os08g30990-LOC_Os08g31000 | intergenic_region ; MODIFIER | silent_mutation | Average:60.698; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0819137940 | C -> DEL | N | N | silent_mutation | Average:60.698; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0819137940 | NA | 5.16E-06 | mr1039 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819137940 | NA | 3.53E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819137940 | NA | 1.49E-11 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819137940 | NA | 5.75E-27 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819137940 | NA | 2.69E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819137940 | NA | 6.64E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819137940 | NA | 4.75E-24 | mr1217 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819137940 | 9.13E-06 | 3.98E-10 | mr1227 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819137940 | NA | 2.44E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0819137940 | NA | 1.27E-22 | mr1254 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/