\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0819131363:

Variant ID: vg0819131363 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 19131363
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGATGGTAGTACCACATGGGAGCATGTAGGTCAATTTTTAGCGCAATGTGGTGAGGCTAATAGTGATACTTTTAAATTACGCTTGTTTTCTTTATCTTT[A/G]
TCCGGTACCGCTTTTACATGGTTTACTTTTTTACCGGCAAATTCTATTCATACTTGGGCTCAATTAGAGGTGAGATTTCATGATTATTTTTATACTGGAG

Reverse complement sequence

CTCCAGTATAAAAATAATCATGAAATCTCACCTCTAATTGAGCCCAAGTATGAATAGAATTTGCCGGTAAAAAAGTAAACCATGTAAAAGCGGTACCGGA[T/C]
AAAGATAAAGAAAACAAGCGTAATTTAAAAGTATCACTATTAGCCTCACCACATTGCGCTAAAAATTGACCTACATGCTCCCATGTGGTACTACCATCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 10.30% 2.07% 0.00% NA
All Indica  2759 98.00% 0.80% 1.20% 0.00% NA
All Japonica  1512 66.30% 29.80% 3.97% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 98.30% 0.70% 1.01% 0.00% NA
Indica II  465 98.90% 0.40% 0.65% 0.00% NA
Indica III  913 97.40% 0.80% 1.86% 0.00% NA
Indica Intermediate  786 97.80% 1.30% 0.89% 0.00% NA
Temperate Japonica  767 41.20% 52.70% 6.13% 0.00% NA
Tropical Japonica  504 96.80% 1.80% 1.39% 0.00% NA
Japonica Intermediate  241 82.20% 15.40% 2.49% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 85.60% 11.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0819131363 A -> G LOC_Os08g30990.1 synonymous_variant ; p.Leu286Leu; LOW synonymous_codon Average:26.299; most accessible tissue: Zhenshan97 flag leaf, score: 41.874 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0819131363 NA 1.17E-09 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 1.10E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 8.71E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 3.51E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 7.16E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 1.05E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 3.71E-08 2.70E-17 mr1002_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 2.85E-11 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 3.11E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 3.21E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 1.23E-07 4.37E-19 mr1182_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 2.87E-09 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 1.87E-13 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 1.34E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 4.00E-08 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 5.34E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 1.68E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 6.36E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0819131363 NA 7.34E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251