Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817748584:

Variant ID: vg0817748584 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17748584
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, A: 0.13, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTCGTGAAAACGGCGTGGAGTCCGGATAAGTTACGCGCGACTTATTCGGTTCGGTTACGCGGAGTGGAGATCGTGCGGGCACCCTGATCAAGCGACTT[T/A]
TCTCTATATAAACCGAGTCGCCGCCTTCACGCAACACACGCGAAATCAATCTAGGGTTTGCCTCCTACTCTGTACTGCGTCGTCGCTCGTAGACTACTCC

Reverse complement sequence

GGAGTAGTCTACGAGCGACGACGCAGTACAGAGTAGGAGGCAAACCCTAGATTGATTTCGCGTGTGTTGCGTGAAGGCGGCGACTCGGTTTATATAGAGA[A/T]
AAGTCGCTTGATCAGGGTGCCCGCACGATCTCCACTCCGCGTAACCGAACCGAATAAGTCGCGCGTAACTTATCCGGACTCCACGCCGTTTTCACGAACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	19.40%	7.50%	0.72%	72.37%	NA
All Indica	2759	1.80%	4.00%	0.87%	93.37%	NA
All Japonica	1512	54.80%	0.10%	0.20%	44.91%	NA
Aus	269	1.50%	85.10%	0.37%	13.01%	NA
Indica I	595	3.20%	0.80%	0.34%	95.63%	NA
Indica II	465	1.90%	5.60%	0.86%	91.61%	NA
Indica III	913	0.50%	3.00%	0.88%	95.62%	NA
Indica Intermediate	786	2.00%	6.60%	1.27%	90.08%	NA
Temperate Japonica	767	82.70%	0.00%	0.26%	17.08%	NA
Tropical Japonica	504	21.60%	0.20%	0.20%	77.98%	NA
Japonica Intermediate	241	35.30%	0.40%	0.00%	64.32%	NA
VI/Aromatic	96	16.70%	4.20%	4.17%	75.00%	NA
Intermediate	90	21.10%	12.20%	2.22%	64.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817748584	T -> A	LOC_Os08g28990.1	upstream_gene_variant ; 4533.0bp to feature; MODIFIER	silent_mutation	Average:10.916; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0817748584	T -> A	LOC_Os08g29000.1	upstream_gene_variant ; 570.0bp to feature; MODIFIER	silent_mutation	Average:10.916; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0817748584	T -> A	LOC_Os08g28990-LOC_Os08g29000	intergenic_region ; MODIFIER	silent_mutation	Average:10.916; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0817748584	T -> DEL	N	N	silent_mutation	Average:10.916; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817748584	NA	6.19E-07	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748584	2.61E-06	2.61E-06	mr1282_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817748584	NA	4.40E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251