Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0817164286:

Variant ID: vg0817164286 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17164286
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCAGGAAGATCCAACCTGGCCAGAGTACGTCTCTCGACGAGATTGGAGTTATCGTCATCAACTATTTGATTCGGCGAGATCGATCAAGCTCCAAGATAT[C/T,A]
ATCGCCGCGAAGGATAATTGTTCAATATCGCCAGATACGAGACTTCGGTTCATGTCGACTACAACGGAACTTGCCGATCTACGATCATAATTGGTCCCGA

Reverse complement sequence

TCGGGACCAATTATGATCGTAGATCGGCAAGTTCCGTTGTAGTCGACATGAACCGAAGTCTCGTATCTGGCGATATTGAACAATTATCCTTCGCGGCGAT[G/A,T]
ATATCTTGGAGCTTGATCGATCTCGCCGAATCAAATAGTTGATGACGATAACTCCAATCTCGTCGAGAGACGTACTCTGGCCAGGTTGGATCTTCCTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.20% 15.90% 0.15% 1.48% A: 0.19%
All Indica  2759 98.60% 1.00% 0.04% 0.00% A: 0.33%
All Japonica  1512 54.50% 40.70% 0.33% 4.43% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 98.80% 0.20% 0.00% 0.00% A: 0.99%
Indica Intermediate  786 98.50% 1.40% 0.13% 0.00% NA
Temperate Japonica  767 69.10% 30.50% 0.39% 0.00% NA
Tropical Japonica  504 39.10% 47.80% 0.40% 12.70% NA
Japonica Intermediate  241 40.20% 58.50% 0.00% 1.24% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 71.10% 24.40% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817164286 C -> T LOC_Os08g28130.1 intron_variant ; MODIFIER silent_mutation Average:43.658; most accessible tissue: Zhenshan97 flower, score: 59.202 N N N N
vg0817164286 C -> A LOC_Os08g28130.1 intron_variant ; MODIFIER silent_mutation Average:43.658; most accessible tissue: Zhenshan97 flower, score: 59.202 N N N N
vg0817164286 C -> DEL N N silent_mutation Average:43.658; most accessible tissue: Zhenshan97 flower, score: 59.202 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817164286 7.58E-07 NA mr1006 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817164286 9.75E-07 NA mr1007 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817164286 8.66E-07 NA mr1052 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817164286 1.68E-07 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817164286 5.23E-06 NA mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817164286 2.27E-06 NA mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817164286 NA 2.83E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817164286 3.19E-06 NA mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817164286 8.37E-06 NA mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251