\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0815304114:

Variant ID: vg0815304114 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 15304114
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AGATCACCTCCTAGGGAACAATTTGGTCATTCACCAAGACGGTCGCATTCACCTCCATATCATCATCCACAAGACATGTCATGGGGTTCTTATCCAATGC[A/C,T]
GCCGCCGGGTTATCCTTATCCTTATTACATGCCATGGGGGGCAACGCCGCCAATGTTCAATCATATGCCTCCAATGCAATTCAACCAAGGGTGGGGAGGA

Reverse complement sequence

TCCTCCCCACCCTTGGTTGAATTGCATTGGAGGCATATGATTGAACATTGGCGGCGTTGCCCCCCATGGCATGTAATAAGGATAAGGATAACCCGGCGGC[T/G,A]
GCATTGGATAAGAACCCCATGACATGTCTTGTGGATGATGATATGGAGGTGAATGCGACCGTCTTGGTGAATGACCAAATTGTTCCCTAGGAGGTGATCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 0.10% 1.42% 3.39% NA
All Indica  2759 92.40% 0.10% 2.28% 5.26% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 94.40% 0.00% 0.37% 5.20% NA
Indica I  595 94.50% 0.00% 1.68% 3.87% NA
Indica II  465 89.00% 0.20% 2.58% 8.17% NA
Indica III  913 91.30% 0.00% 3.18% 5.48% NA
Indica Intermediate  786 93.90% 0.30% 1.53% 4.33% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0815304114 A -> C LOC_Os08g25190.1 missense_variant ; p.Gln177Pro; MODERATE nonsynonymous_codon ; Q177P Average:49.992; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 benign -0.02 TOLERATED 1.00
vg0815304114 A -> T LOC_Os08g25190.1 missense_variant ; p.Gln177Leu; MODERATE N Average:49.992; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg0815304114 A -> T LOC_Os08g25180.1 downstream_gene_variant ; 4771.0bp to feature; MODIFIER N Average:49.992; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg0815304114 A -> DEL LOC_Os08g25190.1 N frameshift_variant Average:49.992; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0815304114 3.05E-06 1.98E-06 mr1036_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 3.59E-06 3.58E-06 mr1046_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 7.35E-06 NA mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 8.03E-06 NA mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 1.17E-06 NA mr1255_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 9.76E-06 5.15E-06 mr1283_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 9.98E-06 3.96E-06 mr1345_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 9.37E-06 9.36E-06 mr1387_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 5.36E-06 NA mr1407_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 9.75E-06 9.78E-06 mr1413_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 7.85E-06 NA mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 NA 7.75E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 1.40E-06 NA mr1537_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 4.88E-07 NA mr1541_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 4.61E-06 NA mr1551_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 6.09E-06 1.15E-06 mr1554_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 1.32E-06 NA mr1557_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 7.23E-06 NA mr1606_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 8.30E-06 6.61E-06 mr1661_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 9.68E-06 NA mr1705_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 8.66E-06 NA mr1714_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 6.32E-06 NA mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 9.67E-06 1.94E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 8.93E-07 7.55E-08 mr1804_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 5.44E-06 NA mr1835_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 5.57E-07 NA mr1844_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 1.82E-06 2.32E-06 mr1849_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 7.99E-06 NA mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0815304114 5.77E-06 NA mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251