\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809969756:

Variant ID: vg0809969756 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9969756
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATCGCCGTGGCACCGTTTCCTATGAGAAGGTATTAATGAAAGTTTCGAATTAGCACGGGCCAATAGTTATCACGGTGAACAGTTTACATATTAAGTTT[C/A]
CTTACCCCTTCTTTAGGGGGAATGTAGTCTTTGTCGCCTTCTTCACTGTCGCCCTTTTTCCTTCTCTTCGGGCTTGGGCTTGGACAAGGATCGCTTGGCG

Reverse complement sequence

CGCCAAGCGATCCTTGTCCAAGCCCAAGCCCGAAGAGAAGGAAAAAGGGCGACAGTGAAGAAGGCGACAAAGACTACATTCCCCCTAAAGAAGGGGTAAG[G/T]
AAACTTAATATGTAAACTGTTCACCGTGATAACTATTGGCCCGTGCTAATTCGAAACTTTCATTAATACCTTCTCATAGGAAACGGTGCCACGGCGATCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 12.90% 1.35% 17.50% NA
All Indica  2759 72.70% 4.30% 1.56% 21.42% NA
All Japonica  1512 58.30% 31.20% 0.73% 9.72% NA
Aus  269 98.10% 0.00% 0.37% 1.49% NA
Indica I  595 96.30% 0.00% 0.00% 3.70% NA
Indica II  465 51.60% 3.00% 1.29% 44.09% NA
Indica III  913 65.40% 6.80% 2.30% 25.52% NA
Indica Intermediate  786 75.70% 5.60% 2.04% 16.67% NA
Temperate Japonica  767 90.90% 8.90% 0.00% 0.26% NA
Tropical Japonica  504 16.10% 56.90% 1.98% 25.00% NA
Japonica Intermediate  241 43.20% 48.50% 0.41% 7.88% NA
VI/Aromatic  96 16.70% 2.10% 6.25% 75.00% NA
Intermediate  90 63.30% 18.90% 3.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809969756 C -> A LOC_Os08g16340.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:25.959; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0809969756 C -> A LOC_Os08g16330.1 downstream_gene_variant ; 4016.0bp to feature; MODIFIER silent_mutation Average:25.959; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg0809969756 C -> DEL N N silent_mutation Average:25.959; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809969756 NA 8.26E-09 mr1028 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 7.41E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 3.02E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 1.01E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 6.65E-06 mr1095 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 2.68E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 9.23E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 4.66E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 4.27E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 8.02E-07 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 2.24E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 2.70E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 2.76E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 8.48E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 1.70E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 8.02E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 3.56E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 6.12E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 2.53E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 1.03E-07 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 2.75E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 1.54E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 4.92E-06 mr1482_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 1.21E-14 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809969756 NA 1.52E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251