Variant ID: vg0808250957 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 8250957 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 99. )
CGATTAAGTCCATTCAAGTCTCAGTAAATTCATAAAAAAGCATAGAATCCACTAAAAATGGTTTTGTTTCCTGTTTCAGTAGACTTATCAAATGTTTTGC[A/T]
TGTGTGCTTTGTTTATCGCGTAGATTTCGGCCGTTTCGTCGATCCGCGATTCCTCGAAGACGTTGCTGTGGTCCCATCAGCGTGAGAGCAAGGCAAGTCA
TGACTTGCCTTGCTCTCACGCTGATGGGACCACAGCAACGTCTTCGAGGAATCGCGGATCGACGAAACGGCCGAAATCTACGCGATAAACAAAGCACACA[T/A]
GCAAAACATTTGATAAGTCTACTGAAACAGGAAACAAAACCATTTTTAGTGGATTCTATGCTTTTTTATGAATTTACTGAGACTTGAATGGACTTAATCG
Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 17.50% | 11.70% | 8.27% | 62.53% | NA |
All Indica | 2759 | 1.60% | 1.40% | 7.36% | 89.67% | NA |
All Japonica | 1512 | 46.20% | 33.30% | 5.03% | 15.54% | NA |
Aus | 269 | 0.00% | 0.00% | 32.71% | 67.29% | NA |
Indica I | 595 | 2.50% | 1.70% | 2.18% | 93.61% | NA |
Indica II | 465 | 0.60% | 2.60% | 15.91% | 80.86% | NA |
Indica III | 913 | 0.80% | 0.10% | 7.23% | 91.89% | NA |
Indica Intermediate | 786 | 2.40% | 1.90% | 6.36% | 89.31% | NA |
Temperate Japonica | 767 | 36.90% | 53.50% | 3.78% | 5.87% | NA |
Tropical Japonica | 504 | 69.00% | 5.80% | 4.37% | 20.83% | NA |
Japonica Intermediate | 241 | 27.80% | 26.60% | 10.37% | 35.27% | NA |
VI/Aromatic | 96 | 72.90% | 0.00% | 15.62% | 11.46% | NA |
Intermediate | 90 | 18.90% | 11.10% | 10.00% | 60.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0808250957 | A -> T | LOC_Os08g13820.1 | upstream_gene_variant ; 434.0bp to feature; MODIFIER | silent_mutation | Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
vg0808250957 | A -> T | LOC_Os08g13830.1 | upstream_gene_variant ; 568.0bp to feature; MODIFIER | silent_mutation | Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
vg0808250957 | A -> T | LOC_Os08g13810.1 | downstream_gene_variant ; 2646.0bp to feature; MODIFIER | silent_mutation | Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
vg0808250957 | A -> T | LOC_Os08g13820-LOC_Os08g13830 | intergenic_region ; MODIFIER | silent_mutation | Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
vg0808250957 | A -> DEL | N | N | silent_mutation | Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0808250957 | NA | 1.98E-12 | Plant_height | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0808250957 | NA | 4.37E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0808250957 | NA | 9.40E-11 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0808250957 | NA | 2.04E-09 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0808250957 | NA | 4.90E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0808250957 | NA | 6.79E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |