\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808250957:

Variant ID: vg0808250957 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8250957
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CGATTAAGTCCATTCAAGTCTCAGTAAATTCATAAAAAAGCATAGAATCCACTAAAAATGGTTTTGTTTCCTGTTTCAGTAGACTTATCAAATGTTTTGC[A/T]
TGTGTGCTTTGTTTATCGCGTAGATTTCGGCCGTTTCGTCGATCCGCGATTCCTCGAAGACGTTGCTGTGGTCCCATCAGCGTGAGAGCAAGGCAAGTCA

Reverse complement sequence

TGACTTGCCTTGCTCTCACGCTGATGGGACCACAGCAACGTCTTCGAGGAATCGCGGATCGACGAAACGGCCGAAATCTACGCGATAAACAAAGCACACA[T/A]
GCAAAACATTTGATAAGTCTACTGAAACAGGAAACAAAACCATTTTTAGTGGATTCTATGCTTTTTTATGAATTTACTGAGACTTGAATGGACTTAATCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.50% 11.70% 8.27% 62.53% NA
All Indica  2759 1.60% 1.40% 7.36% 89.67% NA
All Japonica  1512 46.20% 33.30% 5.03% 15.54% NA
Aus  269 0.00% 0.00% 32.71% 67.29% NA
Indica I  595 2.50% 1.70% 2.18% 93.61% NA
Indica II  465 0.60% 2.60% 15.91% 80.86% NA
Indica III  913 0.80% 0.10% 7.23% 91.89% NA
Indica Intermediate  786 2.40% 1.90% 6.36% 89.31% NA
Temperate Japonica  767 36.90% 53.50% 3.78% 5.87% NA
Tropical Japonica  504 69.00% 5.80% 4.37% 20.83% NA
Japonica Intermediate  241 27.80% 26.60% 10.37% 35.27% NA
VI/Aromatic  96 72.90% 0.00% 15.62% 11.46% NA
Intermediate  90 18.90% 11.10% 10.00% 60.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808250957 A -> T LOC_Os08g13820.1 upstream_gene_variant ; 434.0bp to feature; MODIFIER silent_mutation Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0808250957 A -> T LOC_Os08g13830.1 upstream_gene_variant ; 568.0bp to feature; MODIFIER silent_mutation Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0808250957 A -> T LOC_Os08g13810.1 downstream_gene_variant ; 2646.0bp to feature; MODIFIER silent_mutation Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0808250957 A -> T LOC_Os08g13820-LOC_Os08g13830 intergenic_region ; MODIFIER silent_mutation Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0808250957 A -> DEL N N silent_mutation Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808250957 NA 1.98E-12 Plant_height Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0808250957 NA 4.37E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808250957 NA 9.40E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808250957 NA 2.04E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808250957 NA 4.90E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808250957 NA 6.79E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251