Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808239790:

Variant ID: vg0808239790 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8239790
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTACTCTTTCTATGAAACGGTACGGGCGTTTTGATTTGGAGGAAAAACATAGGAATATTATAGGATTTCTATGGATGCCTTTGAAACAAAGGATTAAAT[C/T]
CTATATTATTTTGATTTGTTTAAGTATGCGCTCTATTCAAAAGCTAGCTAGCTACCAACTTTCACCGTCAACCATAGCAATCTGCCGCAGAATTGAATCA

Reverse complement sequence

TGATTCAATTCTGCGGCAGATTGCTATGGTTGACGGTGAAAGTTGGTAGCTAGCTAGCTTTTGAATAGAGCGCATACTTAAACAAATCAAAATAATATAG[G/A]
ATTTAATCCTTTGTTTCAAAGGCATCCATAGAAATCCTATAATATTCCTATGTTTTTCCTCCAAATCAAAACGCCCGTACCGTTTCATAGAAAGAGTAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 5.50% 15.13% 28.29% NA
All Indica  2759 31.80% 0.50% 24.28% 43.46% NA
All Japonica  1512 83.50% 6.90% 2.25% 7.34% NA
Aus  269 52.40% 46.50% 0.37% 0.74% NA
Indica I  595 21.20% 0.00% 32.27% 46.55% NA
Indica II  465 55.50% 0.00% 17.85% 26.67% NA
Indica III  913 28.30% 0.20% 21.36% 50.16% NA
Indica Intermediate  786 29.80% 1.50% 25.45% 43.26% NA
Temperate Japonica  767 94.30% 0.70% 1.30% 3.78% NA
Tropical Japonica  504 76.80% 16.30% 3.37% 3.57% NA
Japonica Intermediate  241 63.10% 7.50% 2.90% 26.56% NA
VI/Aromatic  96 92.70% 5.20% 0.00% 2.08% NA
Intermediate  90 52.20% 11.10% 11.11% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808239790 C -> T LOC_Os08g13810.1 upstream_gene_variant ; 3961.0bp to feature; MODIFIER silent_mutation Average:91.215; most accessible tissue: Callus, score: 97.153 N N N N
vg0808239790 C -> T LOC_Os08g13800.1 downstream_gene_variant ; 3051.0bp to feature; MODIFIER silent_mutation Average:91.215; most accessible tissue: Callus, score: 97.153 N N N N
vg0808239790 C -> T LOC_Os08g13800-LOC_Os08g13810 intergenic_region ; MODIFIER silent_mutation Average:91.215; most accessible tissue: Callus, score: 97.153 N N N N
vg0808239790 C -> DEL N N silent_mutation Average:91.215; most accessible tissue: Callus, score: 97.153 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0808239790 C T 0.01 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808239790 NA 4.69E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808239790 NA 1.45E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808239790 NA 5.23E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808239790 1.91E-06 NA mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251