\
| Variant ID: vg0808210049 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8210049 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 191. )
CCGGAAACTCGCCTCGTCGCCATCTTGTGCATGCATGATGATCTGAACAGAAAGAGAAGGAAAACAAAAGAAAACTAAGAAGTTAAACTCATGGCGATGG[C/G]
TGAGTACGCTGCTCCGGCGATCGTCTCCTCCTCCGCGCGCCTCCTCGCCAGACGCCGAGGCACTGCGGCCAACGTCACCGGCCGCCGAGCGCACAAGTTC
GAACTTGTGCGCTCGGCGGCCGGTGACGTTGGCCGCAGTGCCTCGGCGTCTGGCGAGGAGGCGCGCGGAGGAGGAGACGATCGCCGGAGCAGCGTACTCA[G/C]
CCATCGCCATGAGTTTAACTTCTTAGTTTTCTTTTGTTTTCCTTCTCTTTCTGTTCAGATCATCATGCATGCACAAGATGGCGACGAGGCGAGTTTCCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.30% | 41.20% | 10.73% | 5.78% | NA |
| All Indica | 2759 | 14.90% | 66.10% | 13.99% | 5.00% | NA |
| All Japonica | 1512 | 85.90% | 1.90% | 3.77% | 8.40% | NA |
| Aus | 269 | 57.60% | 24.20% | 18.22% | 0.00% | NA |
| Indica I | 595 | 10.30% | 67.70% | 16.81% | 5.21% | NA |
| Indica II | 465 | 15.30% | 54.20% | 29.03% | 1.51% | NA |
| Indica III | 913 | 12.70% | 74.50% | 6.24% | 6.57% | NA |
| Indica Intermediate | 786 | 20.70% | 62.20% | 11.96% | 5.09% | NA |
| Temperate Japonica | 767 | 95.20% | 0.40% | 0.65% | 3.78% | NA |
| Tropical Japonica | 504 | 82.30% | 3.40% | 6.55% | 7.74% | NA |
| Japonica Intermediate | 241 | 63.90% | 3.70% | 7.88% | 24.48% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 28.90% | 16.67% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808210049 | C -> G | LOC_Os08g13770.1 | upstream_gene_variant ; 78.0bp to feature; MODIFIER | silent_mutation | Average:33.796; most accessible tissue: Callus, score: 61.447 | N | N | N | N |
| vg0808210049 | C -> G | LOC_Os08g13770-LOC_Os08g13780 | intergenic_region ; MODIFIER | silent_mutation | Average:33.796; most accessible tissue: Callus, score: 61.447 | N | N | N | N |
| vg0808210049 | C -> DEL | N | N | silent_mutation | Average:33.796; most accessible tissue: Callus, score: 61.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808210049 | NA | 6.64E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808210049 | NA | 6.64E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808210049 | NA | 2.71E-12 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808210049 | 2.87E-07 | 3.03E-07 | mr1296_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808210049 | NA | 2.43E-10 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808210049 | NA | 3.26E-06 | mr1749_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808210049 | NA | 5.12E-11 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |