\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808100775:

Variant ID: vg0808100775 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8100775
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.38, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGTACCACGGGGCAATCCATGGAGCCAAGATCGGGCGGAATCTGCTAAAGCCACTGGTAAATAGTTCGCCATGGCCTTGCTGTCTCCTCCTGCTGCGC[A/G]
GATTGCGAGACCGTAGACGGTAAGCCACGATTCTGGGTTAGTGGTACCGTCATACTTCTCTATTCCAGTCGGCTTGAAGCTGGCTGGTCAATCCACTCGA

Reverse complement sequence

TCGAGTGGATTGACCAGCCAGCTTCAAGCCGACTGGAATAGAGAAGTATGACGGTACCACTAACCCAGAATCGTGGCTTACCGTCTACGGTCTCGCAATC[T/C]
GCGCAGCAGGAGGAGACAGCAAGGCCATGGCGAACTATTTACCAGTGGCTTTAGCAGATTCCGCCCGATCTTGGCTCCATGGATTGCCCCGTGGTACAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.90% 10.90% 33.16% 27.00% NA
All Indica  2759 10.90% 17.40% 47.01% 24.68% NA
All Japonica  1512 59.60% 0.30% 6.35% 33.80% NA
Aus  269 19.30% 8.60% 50.56% 21.56% NA
Indica I  595 11.10% 30.90% 21.51% 36.47% NA
Indica II  465 13.30% 17.60% 49.25% 19.78% NA
Indica III  913 9.30% 8.40% 64.29% 17.96% NA
Indica Intermediate  786 11.10% 17.60% 44.91% 26.46% NA
Temperate Japonica  767 86.20% 0.30% 0.91% 12.65% NA
Tropical Japonica  504 19.40% 0.40% 12.70% 67.46% NA
Japonica Intermediate  241 58.90% 0.00% 10.37% 30.71% NA
VI/Aromatic  96 83.30% 0.00% 12.50% 4.17% NA
Intermediate  90 38.90% 7.80% 28.89% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808100775 A -> G LOC_Os08g13620.1 missense_variant ; p.Cys394Arg; MODERATE nonsynonymous_codon ; C394R Average:37.28; most accessible tissue: Minghui63 young leaf, score: 68.07 benign -0.728 TOLERATED 1.00
vg0808100775 A -> DEL LOC_Os08g13620.1 N frameshift_variant Average:37.28; most accessible tissue: Minghui63 young leaf, score: 68.07 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808100775 NA 1.44E-06 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 3.49E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 6.60E-06 1.19E-06 mr1039 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 7.71E-07 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 8.36E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 9.62E-06 mr1066_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 5.34E-09 mr1084_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 1.13E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 8.73E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 9.66E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 2.11E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 6.62E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 5.99E-07 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 2.55E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 2.54E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 3.34E-23 mr1304_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 1.18E-06 NA mr1316_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 1.33E-07 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 5.88E-06 2.49E-09 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 8.14E-06 1.29E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 5.68E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 1.81E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 2.76E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 1.20E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 7.65E-06 2.08E-12 mr1714_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 4.81E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 1.49E-06 NA mr1743_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 2.17E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 1.76E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 7.83E-13 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 3.69E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 1.46E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 3.31E-06 6.42E-10 mr1909_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808100775 NA 1.22E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251