\
| Variant ID: vg0807179141 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7179141 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.07, others allele: 0.00, population size: 62. )
CCGGTGCAAAGCAAGAGTAAACCCTATTAAAGAAATGCAAACAATAATCAAAATTGGCATGTGGAATTTTTCTTGAGTTCTACATGTCGAAATTCACTAA[T/C]
AGGATTTTTAGTGGAATTTTCAGAGCTCTCGAAATAATTTTAACCATTTAAAATTGAGCTTGCAATATTTTAAATTCCAGGGAAATTCTTTTCCTCCTTT
AAAGGAGGAAAAGAATTTCCCTGGAATTTAAAATATTGCAAGCTCAATTTTAAATGGTTAAAATTATTTCGAGAGCTCTGAAAATTCCACTAAAAATCCT[A/G]
TTAGTGAATTTCGACATGTAGAACTCAAGAAAAATTCCACATGCCAATTTTGATTATTGTTTGCATTTCTTTAATAGGGTTTACTCTTGCTTTGCACCGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.40% | 1.00% | 14.60% | 52.05% | NA |
| All Indica | 2759 | 2.10% | 1.00% | 15.88% | 81.04% | NA |
| All Japonica | 1512 | 94.60% | 0.10% | 0.99% | 4.30% | NA |
| Aus | 269 | 0.40% | 3.00% | 56.13% | 40.52% | NA |
| Indica I | 595 | 1.50% | 0.00% | 8.57% | 89.92% | NA |
| Indica II | 465 | 4.30% | 0.90% | 15.48% | 79.35% | NA |
| Indica III | 913 | 0.70% | 1.20% | 18.07% | 80.07% | NA |
| Indica Intermediate | 786 | 2.80% | 1.70% | 19.08% | 76.46% | NA |
| Temperate Japonica | 767 | 93.20% | 0.00% | 0.13% | 6.65% | NA |
| Tropical Japonica | 504 | 96.00% | 0.20% | 2.18% | 1.59% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 1.24% | 2.49% | NA |
| VI/Aromatic | 96 | 4.20% | 8.30% | 77.08% | 10.42% | NA |
| Intermediate | 90 | 42.20% | 0.00% | 13.33% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807179141 | T -> C | LOC_Os08g12190.1 | downstream_gene_variant ; 1391.0bp to feature; MODIFIER | silent_mutation | Average:20.03; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0807179141 | T -> C | LOC_Os08g12190-LOC_Os08g12210 | intergenic_region ; MODIFIER | silent_mutation | Average:20.03; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| vg0807179141 | T -> DEL | N | N | silent_mutation | Average:20.03; most accessible tissue: Minghui63 root, score: 31.271 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807179141 | NA | 4.82E-22 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 9.38E-46 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 9.28E-28 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 7.86E-40 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 2.21E-21 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 7.77E-13 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 2.19E-49 | mr1692 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 1.22E-33 | mr1780 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 3.58E-52 | mr1935 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 1.84E-07 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 2.63E-26 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 3.19E-36 | mr1780_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 7.48E-19 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807179141 | NA | 2.55E-21 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |