\
| Variant ID: vg0806359109 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 6359109 |
| Reference Allele: A | Alternative Allele: C,ACTTCC |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 213. )
CGCCGTCGATGCTTCCTGGACCTCTCCGACCCCTTTCAGCTGCACGGTGAGACACTGCATACCCCTGAACACCCCATGCATGCACCCATATAGCCCATTC[A/C,ACTTCC]
GAGCTGTAGCTCGACACGCATGCACATACCAAGAACCACCGCCGCTGTAGCTTGTTTTTCGCGAGCTACAGACCACCGCTGTAGCTGTAGCTTGTTCATC
GATGAACAAGCTACAGCTACAGCGGTGGTCTGTAGCTCGCGAAAAACAAGCTACAGCGGCGGTGGTTCTTGGTATGTGCATGCGTGTCGAGCTACAGCTC[T/G,GGAAGT]
GAATGGGCTATATGGGTGCATGCATGGGGTGTTCAGGGGTATGCAGTGTCTCACCGTGCAGCTGAAAGGGGTCGGAGAGGTCCAGGAAGCATCGACGGCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 5.10% | 3.51% | 10.52% | ACTTCC: 2.77% |
| All Indica | 2759 | 67.70% | 7.50% | 5.04% | 15.55% | ACTTCC: 4.24% |
| All Japonica | 1512 | 99.00% | 0.10% | 0.26% | 0.66% | NA |
| Aus | 269 | 72.50% | 0.40% | 7.06% | 14.87% | ACTTCC: 5.20% |
| Indica I | 595 | 66.90% | 16.50% | 2.86% | 8.74% | ACTTCC: 5.04% |
| Indica II | 465 | 63.00% | 1.90% | 3.23% | 27.10% | ACTTCC: 4.73% |
| Indica III | 913 | 67.70% | 6.00% | 7.89% | 15.99% | ACTTCC: 2.41% |
| Indica Intermediate | 786 | 71.10% | 5.60% | 4.45% | 13.36% | ACTTCC: 5.47% |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 98.20% | 0.00% | 0.60% | 1.19% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 51.00% | 32.30% | 1.04% | 15.62% | NA |
| Intermediate | 90 | 90.00% | 3.30% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806359109 | A -> C | LOC_Os08g10790.1 | downstream_gene_variant ; 2944.0bp to feature; MODIFIER | silent_mutation | Average:18.007; most accessible tissue: Callus, score: 43.373 | N | N | N | N |
| vg0806359109 | A -> C | LOC_Os08g10800.1 | intron_variant ; MODIFIER | silent_mutation | Average:18.007; most accessible tissue: Callus, score: 43.373 | N | N | N | N |
| vg0806359109 | A -> DEL | N | N | silent_mutation | Average:18.007; most accessible tissue: Callus, score: 43.373 | N | N | N | N |
| vg0806359109 | A -> ACTTCC | LOC_Os08g10790.1 | downstream_gene_variant ; 2945.0bp to feature; MODIFIER | silent_mutation | Average:18.007; most accessible tissue: Callus, score: 43.373 | N | N | N | N |
| vg0806359109 | A -> ACTTCC | LOC_Os08g10800.1 | intron_variant ; MODIFIER | silent_mutation | Average:18.007; most accessible tissue: Callus, score: 43.373 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806359109 | 9.95E-08 | 2.73E-11 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | 2.26E-09 | 2.81E-13 | mr1038 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | 5.45E-08 | 4.34E-12 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | 2.47E-09 | 9.89E-13 | mr1389 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | 6.20E-08 | 2.14E-13 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | 1.99E-09 | 4.72E-14 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | NA | 1.28E-06 | mr1057_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | 1.23E-06 | NA | mr1141_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | 7.20E-07 | NA | mr1141_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | NA | 5.88E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | NA | 3.15E-06 | mr1266_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | NA | 2.55E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | NA | 1.70E-09 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | 7.54E-07 | 7.53E-07 | mr1906_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | NA | 1.19E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | NA | 3.85E-06 | mr1924_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | NA | 5.35E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806359109 | NA | 5.89E-06 | mr1960_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |