| Variant ID: vg0805577321 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5577321 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAGTTTTGTAATAAAATAGTTGTTAAATCAATAGTTTTGTGATATAATATCTTAAATCTGTAGTTCCATGATAAATTTAACTCTAAATCTATAGTTTTGT[A/G]
AAATACATTCTTAAATATGTAGTTTTGTGATAGATTGATCAAAGTATCTGTAGTTTTGTGAAATTTACTCTATTAAGAAATATGGGTGACCGGTGAGGAC
GTCCTCACCGGTCACCCATATTTCTTAATAGAGTAAATTTCACAAAACTACAGATACTTTGATCAATCTATCACAAAACTACATATTTAAGAATGTATTT[T/C]
ACAAAACTATAGATTTAGAGTTAAATTTATCATGGAACTACAGATTTAAGATATTATATCACAAAACTATTGATTTAACAACTATTTTATTACAAAACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.30% | 30.30% | 1.04% | 23.32% | NA |
| All Indica | 2759 | 28.60% | 40.00% | 0.43% | 30.95% | NA |
| All Japonica | 1512 | 86.20% | 0.80% | 0.26% | 12.70% | NA |
| Aus | 269 | 0.40% | 98.90% | 0.00% | 0.74% | NA |
| Indica I | 595 | 44.00% | 14.30% | 0.50% | 41.18% | NA |
| Indica II | 465 | 43.90% | 11.60% | 0.22% | 44.30% | NA |
| Indica III | 913 | 11.20% | 73.80% | 0.44% | 14.57% | NA |
| Indica Intermediate | 786 | 28.10% | 37.00% | 0.51% | 34.35% | NA |
| Temperate Japonica | 767 | 96.20% | 0.40% | 0.00% | 3.39% | NA |
| Tropical Japonica | 504 | 75.00% | 1.00% | 0.60% | 23.41% | NA |
| Japonica Intermediate | 241 | 78.00% | 1.70% | 0.41% | 19.92% | NA |
| VI/Aromatic | 96 | 7.30% | 32.30% | 28.12% | 32.29% | NA |
| Intermediate | 90 | 46.70% | 21.10% | 6.67% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805577321 | A -> G | LOC_Os08g09640.1 | upstream_gene_variant ; 2937.0bp to feature; MODIFIER | silent_mutation | Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0805577321 | A -> G | LOC_Os08g09660.1 | upstream_gene_variant ; 3256.0bp to feature; MODIFIER | silent_mutation | Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0805577321 | A -> G | LOC_Os08g09650.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0805577321 | A -> DEL | N | N | silent_mutation | Average:39.415; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805577321 | NA | 8.60E-09 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805577321 | NA | 1.36E-11 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805577321 | NA | 2.37E-06 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805577321 | NA | 4.13E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805577321 | NA | 5.34E-07 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805577321 | NA | 3.67E-07 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805577321 | NA | 9.99E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805577321 | NA | 2.38E-08 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805577321 | NA | 1.57E-07 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805577321 | NA | 9.97E-10 | mr1803 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/