\
| Variant ID: vg0804875760 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4875760 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 69. )
TCCACGTTCAAAACCCCTTTGGTTTCTGATGAATTGCCACCAAAGTCTTTAAGCACCATGTTCGTCTTGATGAGGTCTTCGGCGTTCCTACCCAATTTCC[C/T]
GAAGGTAGCATAAGGCATCAAGTTTACTGCAGCCCCACCATCGACCATCATCTTAGACATCGGCTTCCCATTGACATAACCGTTTATATACAATGGTTTA
TAAACCATTGTATATAAACGGTTATGTCAATGGGAAGCCGATGTCTAAGATGATGGTCGATGGTGGGGCTGCAGTAAACTTGATGCCTTATGCTACCTTC[G/A]
GGAAATTGGGTAGGAACGCCGAAGACCTCATCAAGACGAACATGGTGCTTAAAGACTTTGGTGGCAATTCATCAGAAACCAAAGGGGTTTTGAACGTGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.90% | 22.30% | 8.80% | 27.02% | NA |
| All Indica | 2759 | 46.90% | 3.60% | 10.66% | 38.85% | NA |
| All Japonica | 1512 | 27.70% | 61.60% | 4.23% | 6.48% | NA |
| Aus | 269 | 80.30% | 0.40% | 14.50% | 4.83% | NA |
| Indica I | 595 | 20.30% | 5.90% | 7.06% | 66.72% | NA |
| Indica II | 465 | 61.70% | 5.20% | 19.35% | 13.76% | NA |
| Indica III | 913 | 57.50% | 0.30% | 6.68% | 35.49% | NA |
| Indica Intermediate | 786 | 45.80% | 4.80% | 12.85% | 36.51% | NA |
| Temperate Japonica | 767 | 2.90% | 88.40% | 1.83% | 6.91% | NA |
| Tropical Japonica | 504 | 63.30% | 19.20% | 9.13% | 8.33% | NA |
| Japonica Intermediate | 241 | 32.40% | 64.70% | 1.66% | 1.24% | NA |
| VI/Aromatic | 96 | 13.50% | 2.10% | 4.17% | 80.21% | NA |
| Intermediate | 90 | 42.20% | 22.20% | 16.67% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804875760 | C -> T | LOC_Os08g08460.1 | missense_variant ; p.Gly1028Arg; MODERATE | nonsynonymous_codon ; G1028R | Average:21.905; most accessible tissue: Minghui63 flower, score: 40.98 | possibly damaging |
-1.51 |
TOLERATED | 1.00 |
| vg0804875760 | C -> DEL | LOC_Os08g08460.1 | N | frameshift_variant | Average:21.905; most accessible tissue: Minghui63 flower, score: 40.98 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804875760 | NA | 1.84E-07 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 1.42E-08 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 6.07E-08 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 4.81E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 1.14E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 9.79E-06 | mr1294 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 7.91E-09 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 6.43E-07 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | 1.36E-06 | 3.69E-11 | mr1382 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | 5.12E-06 | 9.36E-07 | mr1382 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 3.42E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 2.85E-07 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 1.19E-07 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 3.73E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 1.11E-08 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 3.35E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 3.48E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 4.34E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 3.36E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 7.48E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 9.56E-07 | mr1291_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 1.47E-09 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 6.29E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804875760 | NA | 1.08E-06 | mr1892_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |