\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804875760:

Variant ID: vg0804875760 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4875760
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


TCCACGTTCAAAACCCCTTTGGTTTCTGATGAATTGCCACCAAAGTCTTTAAGCACCATGTTCGTCTTGATGAGGTCTTCGGCGTTCCTACCCAATTTCC[C/T]
GAAGGTAGCATAAGGCATCAAGTTTACTGCAGCCCCACCATCGACCATCATCTTAGACATCGGCTTCCCATTGACATAACCGTTTATATACAATGGTTTA

Reverse complement sequence

TAAACCATTGTATATAAACGGTTATGTCAATGGGAAGCCGATGTCTAAGATGATGGTCGATGGTGGGGCTGCAGTAAACTTGATGCCTTATGCTACCTTC[G/A]
GGAAATTGGGTAGGAACGCCGAAGACCTCATCAAGACGAACATGGTGCTTAAAGACTTTGGTGGCAATTCATCAGAAACCAAAGGGGTTTTGAACGTGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.90% 22.30% 8.80% 27.02% NA
All Indica  2759 46.90% 3.60% 10.66% 38.85% NA
All Japonica  1512 27.70% 61.60% 4.23% 6.48% NA
Aus  269 80.30% 0.40% 14.50% 4.83% NA
Indica I  595 20.30% 5.90% 7.06% 66.72% NA
Indica II  465 61.70% 5.20% 19.35% 13.76% NA
Indica III  913 57.50% 0.30% 6.68% 35.49% NA
Indica Intermediate  786 45.80% 4.80% 12.85% 36.51% NA
Temperate Japonica  767 2.90% 88.40% 1.83% 6.91% NA
Tropical Japonica  504 63.30% 19.20% 9.13% 8.33% NA
Japonica Intermediate  241 32.40% 64.70% 1.66% 1.24% NA
VI/Aromatic  96 13.50% 2.10% 4.17% 80.21% NA
Intermediate  90 42.20% 22.20% 16.67% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804875760 C -> T LOC_Os08g08460.1 missense_variant ; p.Gly1028Arg; MODERATE nonsynonymous_codon ; G1028R Average:21.905; most accessible tissue: Minghui63 flower, score: 40.98 possibly damaging -1.51 TOLERATED 1.00
vg0804875760 C -> DEL LOC_Os08g08460.1 N frameshift_variant Average:21.905; most accessible tissue: Minghui63 flower, score: 40.98 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804875760 NA 1.84E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 1.42E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 6.07E-08 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 4.81E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 1.14E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 9.79E-06 mr1294 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 7.91E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 6.43E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 1.36E-06 3.69E-11 mr1382 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 5.12E-06 9.36E-07 mr1382 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 3.42E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 2.85E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 1.19E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 3.73E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 1.11E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 3.35E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 3.48E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 4.34E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 3.36E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 7.48E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 9.56E-07 mr1291_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 1.47E-09 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 6.29E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804875760 NA 1.08E-06 mr1892_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251