Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802054978:

Variant ID: vg0802054978 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2054978
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CATGTACATATATACATCCCGCATAAGTACATAAACAACTAGAAAATTAAACAACCAATGTGAAATCTATAATTTATCACCCATGTGTACTCTCTGGTTC[C/T]
ATTATTTTGTCGCTTTGGATAATAACACGGTCTCAAAAACATATGTTTAGCTATGATTTTTATTATAGCATATTATCTCCATCCTAAAATATAACAACTT

Reverse complement sequence

AAGTTGTTATATTTTAGGATGGAGATAATATGCTATAATAAAAATCATAGCTAAACATATGTTTTTGAGACCGTGTTATTATCCAAAGCGACAAAATAAT[G/A]
GAACCAGAGAGTACACATGGGTGATAAATTATAGATTTCACATTGGTTGTTTAATTTTCTAGTTGTTTATGTACTTATGCGGGATGTATATATGTACATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.70%	4.90%	0.47%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.00%	0.00%	NA
All Japonica	1512	96.40%	2.20%	1.46%	0.00%	NA
Aus	269	35.70%	64.30%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.00%	1.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.10%	0.00%	0.00%	NA
Temperate Japonica	767	93.50%	4.20%	2.35%	0.00%	NA
Tropical Japonica	504	99.20%	0.20%	0.60%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802054978	C -> T	LOC_Os08g04220.1	upstream_gene_variant ; 2950.0bp to feature; MODIFIER	silent_mutation	Average:63.612; most accessible tissue: Callus, score: 92.975	N	N	N	N
vg0802054978	C -> T	LOC_Os08g04230.1	downstream_gene_variant ; 4673.0bp to feature; MODIFIER	silent_mutation	Average:63.612; most accessible tissue: Callus, score: 92.975	N	N	N	N
vg0802054978	C -> T	LOC_Os08g04210.1	intron_variant ; MODIFIER	silent_mutation	Average:63.612; most accessible tissue: Callus, score: 92.975	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802054978	NA	2.41E-13	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978	NA	2.43E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978	7.66E-07	1.79E-23	mr1515	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978	NA	1.24E-11	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978	NA	2.59E-17	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978	NA	9.96E-09	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978	5.36E-07	6.04E-25	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978	NA	5.48E-14	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978	NA	1.56E-07	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251