| Variant ID: vg0801634981 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1634981 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAGCGGGGCACCCGCGCGTTCATGCGGCGGCGCGACCTCGAGTCGTCGGCGTTCGTCCGCGACGACCGCCTCATCGTCGAGTGCGTCATCGACGTCGTCG[T/C]
CGCCAACGGCGGCGACGACGACACGGCGGCCGCGGCGTCCCCCCTCGCCGGCGTGCCGGCGCCGGACCTGTCGAGGCACCTCGGCGAGCTGCTGGAGCGG
CCGCTCCAGCAGCTCGCCGAGGTGCCTCGACAGGTCCGGCGCCGGCACGCCGGCGAGGGGGGACGCCGCGGCCGCCGTGTCGTCGTCGCCGCCGTTGGCG[A/G]
CGACGACGTCGATGACGCACTCGACGATGAGGCGGTCGTCGCGGACGAACGCCGACGACTCGAGGTCGCGCCGCCGCATGAACGCGCGGGTGCCCCGCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.40% | 5.40% | 3.32% | 20.88% | NA |
| All Indica | 2759 | 58.20% | 1.20% | 5.62% | 35.05% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.00% | 0.20% | NA |
| Aus | 269 | 18.20% | 80.70% | 0.00% | 1.12% | NA |
| Indica I | 595 | 69.60% | 0.00% | 6.89% | 23.53% | NA |
| Indica II | 465 | 81.90% | 0.20% | 3.44% | 14.41% | NA |
| Indica III | 913 | 37.20% | 1.00% | 7.12% | 54.65% | NA |
| Indica Intermediate | 786 | 59.80% | 2.80% | 4.20% | 33.21% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 80.00% | 3.30% | 2.22% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801634981 | T -> C | LOC_Os08g03490.1 | missense_variant ; p.Val160Ala; MODERATE | nonsynonymous_codon ; V160A | Average:75.884; most accessible tissue: Zhenshan97 root, score: 82.361 | unknown | unknown | TOLERATED | 0.68 |
| vg0801634981 | T -> DEL | LOC_Os08g03490.1 | N | frameshift_variant | Average:75.884; most accessible tissue: Zhenshan97 root, score: 82.361 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801634981 | NA | 7.05E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801634981 | NA | 2.44E-18 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801634981 | NA | 7.85E-06 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801634981 | NA | 4.66E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801634981 | NA | 1.14E-07 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801634981 | NA | 1.45E-15 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801634981 | NA | 8.76E-13 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |