| Variant ID: vg0800121546 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 121546 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.00, others allele: 0.00, population size: 241. )
TTCACAAGTGAAAGTGGCTTGATAATAATATACATTATTGGTACTACTATGAAACTTTTATCCATGTCAATCAATGAGAAGAAGTTGGTGGGCCAACTTA[A/C]
ATTTAATTGACTAATATTTGTGCCATGAAAGCAAAATAAATACCACGTCACCACCTACATACTAAAACTACCTATAAAACCACTCTAGGAGGTTATTTGA
TCAAATAACCTCCTAGAGTGGTTTTATAGGTAGTTTTAGTATGTAGGTGGTGACGTGGTATTTATTTTGCTTTCATGGCACAAATATTAGTCAATTAAAT[T/G]
TAAGTTGGCCCACCAACTTCTTCTCATTGATTGACATGGATAAAAGTTTCATAGTAGTACCAATAATGTATATTATTATCAAGCCACTTTCACTTGTGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 5.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 58.70% | 40.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0800121546 | A -> C | LOC_Os08g01180.1 | upstream_gene_variant ; 425.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0800121546 | A -> C | LOC_Os08g01180-LOC_Os08g01190 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0800121546 | NA | 2.03E-11 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800121546 | 8.30E-07 | 3.50E-08 | mr1577 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800121546 | NA | 8.37E-08 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800121546 | NA | 9.61E-07 | mr1684 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800121546 | NA | 1.20E-07 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0800121546 | NA | 2.00E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |