Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800121546:

Variant ID: vg0800121546 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 121546
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TTCACAAGTGAAAGTGGCTTGATAATAATATACATTATTGGTACTACTATGAAACTTTTATCCATGTCAATCAATGAGAAGAAGTTGGTGGGCCAACTTA[A/C]
ATTTAATTGACTAATATTTGTGCCATGAAAGCAAAATAAATACCACGTCACCACCTACATACTAAAACTACCTATAAAACCACTCTAGGAGGTTATTTGA

Reverse complement sequence

TCAAATAACCTCCTAGAGTGGTTTTATAGGTAGTTTTAGTATGTAGGTGGTGACGTGGTATTTATTTTGCTTTCATGGCACAAATATTAGTCAATTAAAT[T/G]
TAAGTTGGCCCACCAACTTCTTCTCATTGATTGACATGGATAAAAGTTTCATAGTAGTACCAATAATGTATATTATTATCAAGCCACTTTCACTTGTGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 5.40% 0.04% 0.00% NA
All Indica  2759 95.00% 5.00% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 58.70% 40.50% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 92.70% 7.30% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800121546 A -> C LOC_Os08g01180.1 upstream_gene_variant ; 425.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800121546 A -> C LOC_Os08g01180-LOC_Os08g01190 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800121546 NA 2.03E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800121546 8.30E-07 3.50E-08 mr1577 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800121546 NA 8.37E-08 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800121546 NA 9.61E-07 mr1684 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800121546 NA 1.20E-07 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800121546 NA 2.00E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251