\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0729105428:

Variant ID: vg0729105428 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 29105428
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCCATATTTATCTATCAACACAATACAGTAGATAACTCAGGTCTGCATACCAGCGATGCAAATAGCCCAGCAGCAGATTAGGTCCAACTCCAGATGGT[A/G]
AAACATCATCCATGATGCCTCGGAAAAAATCCACATAGGTGAAAACAACTGACTTGCTTGAATTCTGTAAGGACGTTGAAAAAGCACTTTAATCAATCAG

Reverse complement sequence

CTGATTGATTAAAGTGCTTTTTCAACGTCCTTACAGAATTCAAGCAAGTCAGTTGTTTTCACCTATGTGGATTTTTTCCGAGGCATCATGGATGATGTTT[T/C]
ACCATCTGGAGTTGGACCTAATCTGCTGCTGGGCTATTTGCATCGCTGGTATGCAGACCTGAGTTATCTACTGTATTGTGTTGATAGATAAATATGGCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.70% 1.50% 0.87% 0.00% NA
All Indica  2759 96.10% 2.50% 1.41% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 88.40% 8.10% 3.53% 0.00% NA
Indica II  465 97.60% 0.90% 1.51% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 2.20% 1.40% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0729105428 A -> G LOC_Os07g48610.1 upstream_gene_variant ; 4475.0bp to feature; MODIFIER silent_mutation Average:41.224; most accessible tissue: Callus, score: 75.02 N N N N
vg0729105428 A -> G LOC_Os07g48602-LOC_Os07g48610 intergenic_region ; MODIFIER silent_mutation Average:41.224; most accessible tissue: Callus, score: 75.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0729105428 4.41E-51 8.54E-65 mr1038 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729105428 5.89E-19 3.09E-20 mr1141 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729105428 1.02E-68 1.07E-85 mr1389 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729105428 2.41E-88 2.60E-105 mr1038_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729105428 5.77E-33 1.29E-25 mr1141_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0729105428 1.22E-89 8.33E-107 mr1389_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251