\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728386754:

Variant ID: vg0728386754 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28386754
Reference Allele: GAlternative Allele: T,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.05, T: 0.04, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGAACCAACCAAAGATTTCGCGGTCGCGTTGCAACCCCAGAGGGAGGACGCGCGTAGTACTAGTACTACTCTCTCCGTAAAAAAAAAAAAAAAAAGCTAG[G/T,A]
AAATTAAAGACGTACCTCCAAATATTTTTTAAGAAGAAATTACGAGCCTCCGCATCATTGAAAAAAGAAGAGATTTAGAAGGAAAGACGTGCCTTCAAAT

Reverse complement sequence

ATTTGAAGGCACGTCTTTCCTTCTAAATCTCTTCTTTTTTCAATGATGCGGAGGCTCGTAATTTCTTCTTAAAAAATATTTGGAGGTACGTCTTTAATTT[C/A,T]
CTAGCTTTTTTTTTTTTTTTTTACGGAGAGAGTAGTACTAGTACTACGCGCGTCCTCCCTCTGGGGTTGCAACGCGACCGCGAAATCTTTGGTTGGTTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 30.10% 0.55% 0.00% A: 0.02%
All Indica  2759 89.10% 10.70% 0.25% 0.00% NA
All Japonica  1512 49.90% 49.10% 1.06% 0.00% NA
Aus  269 5.20% 93.30% 1.12% 0.00% A: 0.37%
Indica I  595 93.80% 6.20% 0.00% 0.00% NA
Indica II  465 97.00% 2.60% 0.43% 0.00% NA
Indica III  913 82.50% 17.50% 0.00% 0.00% NA
Indica Intermediate  786 88.50% 10.80% 0.64% 0.00% NA
Temperate Japonica  767 21.60% 76.50% 1.83% 0.00% NA
Tropical Japonica  504 83.30% 16.50% 0.20% 0.00% NA
Japonica Intermediate  241 69.70% 29.90% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728386754 G -> A LOC_Os07g47480.2 downstream_gene_variant ; 2609.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> A LOC_Os07g47490.1 downstream_gene_variant ; 4971.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> A LOC_Os07g47480.1 downstream_gene_variant ; 2609.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> A LOC_Os07g47490.2 downstream_gene_variant ; 4944.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> A LOC_Os07g47490.4 downstream_gene_variant ; 4944.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> A LOC_Os07g47490.3 downstream_gene_variant ; 4971.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> A LOC_Os07g47480-LOC_Os07g47490 intergenic_region ; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> T LOC_Os07g47480.2 downstream_gene_variant ; 2609.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> T LOC_Os07g47490.1 downstream_gene_variant ; 4971.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> T LOC_Os07g47480.1 downstream_gene_variant ; 2609.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> T LOC_Os07g47490.2 downstream_gene_variant ; 4944.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> T LOC_Os07g47490.4 downstream_gene_variant ; 4944.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> T LOC_Os07g47490.3 downstream_gene_variant ; 4971.0bp to feature; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N
vg0728386754 G -> T LOC_Os07g47480-LOC_Os07g47490 intergenic_region ; MODIFIER silent_mutation Average:86.976; most accessible tissue: Callus, score: 94.864 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0728386754 G A -0.03 0.0 0.01 -0.01 -0.02 -0.03
vg0728386754 G T 0.0 -0.01 0.01 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728386754 NA 8.05E-17 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728386754 NA 8.34E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728386754 NA 7.30E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 6.80E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 4.16E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 9.45E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 4.40E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.02E-06 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.28E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 8.36E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.51E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.10E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 6.19E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 4.64E-20 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 3.23E-08 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 7.85E-07 mr1263 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.54E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 2.82E-07 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 3.60E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 5.67E-08 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 3.31E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.65E-06 mr1440 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 7.85E-07 mr1451 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.57E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.77E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 8.44E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 9.47E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 5.67E-08 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.76E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 6.42E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 4.04E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 4.64E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 9.04E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 3.75E-06 NA mr1729 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 7.22E-11 mr1729 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.70E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.65E-08 mr1740 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 3.99E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 2.89E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.08E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 5.17E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 3.96E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 3.58E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 2.32E-07 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 8.21E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 8.99E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 9.33E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 1.77E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 6.76E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 4.37E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728386754 NA 5.25E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251