Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728373894:

Variant ID: vg0728373894 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28373894
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCCTTCTTGCCTCGACCATGTCACCTTCATTGCAATGGATGCTGATCAACGTAGTGTAGCTTACATGGTTTGGCCTGACACCCTTCTCAATCATGATA[C/T]
GCAATAGATTCTTGGCCTCATCCATTCTATTCGCCCTGCGGAGGCCACATGCTAGTGTGTTGTATGTATACACATCCAGCTCGATGCCCATCTTCTCCAT

Reverse complement sequence

ATGGAGAAGATGGGCATCGAGCTGGATGTGTATACATACAACACACTAGCATGTGGCCTCCGCAGGGCGAATAGAATGGATGAGGCCAAGAATCTATTGC[G/A]
TATCATGATTGAGAAGGGTGTCAGGCCAAACCATGTAAGCTACACTACGTTGATCAGCATCCATTGCAATGAAGGTGACATGGTCGAGGCAAGAAGGCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 4.90% 0.00% 0.00% NA
All Indica  2759 92.50% 7.50% 0.00% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 87.20% 12.80% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728373894 C -> T LOC_Os07g47470.1 missense_variant ; p.Arg377His; MODERATE nonsynonymous_codon ; R377H Average:77.215; most accessible tissue: Zhenshan97 young leaf, score: 85.364 possibly damaging -1.538 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0728373894 C T 0.0 0.0 0.0 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728373894 NA 1.24E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728373894 NA 4.20E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251