| Variant ID: vg0728208708 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 28208708 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, A: 0.32, others allele: 0.00, population size: 218. )
TTCTGCAAGTAACACTAGTTCAATTGTCTTTAGTGCCTGGGATAGTGAGATGGAACTGAGCAGTATCAAGAATAATAAACTGCATTATTGTCTTTCGTAT[T/A]
GTTTGCCATTAAGGCCGTTGTGATGCTAGAAAAATTAAGAGTTTAAGACTTCATTGGCAACCACAACAATGTTCAGAATTTCATCTTTAAGGTTCAAATA
TATTTGAACCTTAAAGATGAAATTCTGAACATTGTTGTGGTTGCCAATGAAGTCTTAAACTCTTAATTTTTCTAGCATCACAACGGCCTTAATGGCAAAC[A/T]
ATACGAAAGACAATAATGCAGTTTATTATTCTTGATACTGCTCAGTTCCATCTCACTATCCCAGGCACTAAAGACAATTGAACTAGTGTTACTTGCAGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.50% | 12.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 78.90% | 21.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 39.60% | 60.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.00% | 14.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.50% | 21.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0728208708 | T -> A | LOC_Os07g47194.1 | downstream_gene_variant ; 1332.0bp to feature; MODIFIER | silent_mutation | Average:38.937; most accessible tissue: Callus, score: 81.06 | N | N | N | N |
| vg0728208708 | T -> A | LOC_Os07g47194.3 | downstream_gene_variant ; 1332.0bp to feature; MODIFIER | silent_mutation | Average:38.937; most accessible tissue: Callus, score: 81.06 | N | N | N | N |
| vg0728208708 | T -> A | LOC_Os07g47194.2 | downstream_gene_variant ; 1787.0bp to feature; MODIFIER | silent_mutation | Average:38.937; most accessible tissue: Callus, score: 81.06 | N | N | N | N |
| vg0728208708 | T -> A | LOC_Os07g47180.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.937; most accessible tissue: Callus, score: 81.06 | N | N | N | N |
| vg0728208708 | T -> A | LOC_Os07g47180.2 | intron_variant ; MODIFIER | silent_mutation | Average:38.937; most accessible tissue: Callus, score: 81.06 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0728208708 | NA | 8.59E-07 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728208708 | NA | 3.52E-07 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728208708 | NA | 3.38E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728208708 | NA | 1.60E-09 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728208708 | NA | 6.46E-09 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728208708 | NA | 4.80E-06 | mr1296_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728208708 | NA | 2.35E-10 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728208708 | NA | 1.76E-09 | mr1327_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728208708 | NA | 2.11E-14 | mr1330_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0728208708 | NA | 3.10E-07 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/