\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728114135:

Variant ID: vg0728114135 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 28114135
Reference Allele: GCGGTGCCGCCCTGGTCACGCAAlternative Allele: G,CCGGTGCCGCCCTGGTCACGCA
Primary Allele: GCGGTGCCGCCCTGGTCACG CASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTGTGCATGCACGACCAGACCATGCACGACCAGATCATGCATGTGTGCATGTGCATGCATGTACTGCTCGGTCACGCGCGGCCGGCCTGCGTGACCGC[GCGGTGCCGCCCTGGTCACGCA/G,CCGGTGCCGCCCTGGTCACGCA]
CGGTGCCGCCCGCAGGACCGACGCGGTGGTTGCGTCCCCCGCGTGCCATCACGATACCGCTCTCCCGGGCTGCGGGAGAAAGGCGGTGCCGCACGGCTGG

Reverse complement sequence

CCAGCCGTGCGGCACCGCCTTTCTCCCGCAGCCCGGGAGAGCGGTATCGTGATGGCACGCGGGGGACGCAACCACCGCGTCGGTCCTGCGGGCGGCACCG[TGCGTGACCAGGGCGGCACCGC/C,TGCGTGACCAGGGCGGCACCGG]
GCGGTCACGCAGGCCGGCCGCGCGTGACCGAGCAGTACATGCATGCACATGCACACATGCATGATCTGGTCGTGCATGGTCTGGTCGTGCATGCACACAT

Allele Frequencies:

Populations Population SizeFrequency of GCGGTGCCGCCCTGGTCACG CA(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 12.90% 2.73% 0.00% CCGGTGCCGCCCTGGTCACGCA: 0.25%
All Indica  2759 78.00% 17.20% 4.35% 0.00% CCGGTGCCGCCCTGGTCACGCA: 0.43%
All Japonica  1512 96.20% 3.40% 0.40% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 69.10% 21.30% 9.58% 0.00% NA
Indica II  465 88.40% 7.30% 3.01% 0.00% CCGGTGCCGCCCTGGTCACGCA: 1.29%
Indica III  913 75.50% 22.70% 1.42% 0.00% CCGGTGCCGCCCTGGTCACGCA: 0.44%
Indica Intermediate  786 81.60% 13.60% 4.58% 0.00% CCGGTGCCGCCCTGGTCACGCA: 0.25%
Temperate Japonica  767 96.20% 3.30% 0.52% 0.00% NA
Tropical Japonica  504 95.20% 4.40% 0.40% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 34.40% 63.50% 2.08% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> G LOC_Os07g47030.1 upstream_gene_variant ; 4580.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> G LOC_Os07g47040.1 upstream_gene_variant ; 3937.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> G LOC_Os07g47030.2 upstream_gene_variant ; 4827.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> G LOC_Os07g47030.4 upstream_gene_variant ; 4550.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> G LOC_Os07g47030.3 upstream_gene_variant ; 4580.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> G LOC_Os07g47040.3 upstream_gene_variant ; 4011.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> G LOC_Os07g47030-LOC_Os07g47040 intergenic_region ; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> CCGGTGCCGCCCTGGTCACGCA LOC_Os07g47030.1 upstream_gene_variant ; 4579.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> CCGGTGCCGCCCTGGTCACGCA LOC_Os07g47040.1 upstream_gene_variant ; 3938.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> CCGGTGCCGCCCTGGTCACGCA LOC_Os07g47030.2 upstream_gene_variant ; 4826.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> CCGGTGCCGCCCTGGTCACGCA LOC_Os07g47030.4 upstream_gene_variant ; 4549.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> CCGGTGCCGCCCTGGTCACGCA LOC_Os07g47030.3 upstream_gene_variant ; 4579.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> CCGGTGCCGCCCTGGTCACGCA LOC_Os07g47040.3 upstream_gene_variant ; 4012.0bp to feature; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N
vg0728114135 GCGGTGCCGCCCTGGTCACGCA -> CCGGTGCCGCCCTGGTCACGCA LOC_Os07g47030-LOC_Os07g47040 intergenic_region ; MODIFIER silent_mutation Average:94.584; most accessible tissue: Zhenshan97 panicle, score: 98.658 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0728114135 GCGGT* CCGGT* 0.02 -0.02 0.0 0.02 0.03 0.03
vg0728114135 GCGGT* G 0.04 0.09 0.09 0.02 0.14 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728114135 NA 1.65E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 3.43E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 6.13E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.73E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 4.83E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 6.57E-06 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.56E-06 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.92E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 3.66E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 9.65E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 5.71E-08 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.16E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.58E-07 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.83E-07 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 9.38E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.88E-07 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.45E-10 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 3.53E-07 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.29E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 8.09E-06 mr1684 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 5.59E-06 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 3.09E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 7.86E-11 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 9.55E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 9.23E-09 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 8.75E-11 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 6.64E-10 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.35E-09 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.49E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 4.56E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 3.50E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.40E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.11E-09 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 7.44E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 9.36E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 6.46E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.64E-07 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.06E-08 mr1296_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.01E-11 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 3.62E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 3.74E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 9.83E-11 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.48E-09 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 6.55E-16 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 4.08E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 3.26E-07 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 5.43E-09 mr1332_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 9.19E-07 mr1355_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 4.07E-08 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.27E-08 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 6.65E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 5.75E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 8.26E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 8.40E-08 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 4.21E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 5.97E-07 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.65E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.18E-06 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 7.43E-06 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 3.75E-08 mr1712_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 6.01E-13 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.21E-06 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 7.45E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.28E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 1.04E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 5.26E-07 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.77E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728114135 NA 2.52E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251