Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724212725:

Variant ID: vg0724212725 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24212725
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTCTAGTAGGTTCAGATCGAATCGGCTGGCGTTGCGTACCTTGCGTTCGTGCATCTATGCACCGGTGTATCCTTTTCAATCGTTGAACTACTGGATCG[T/C]
TTGATGCAAGCGAATATTTTGCTACTACTCGTACTATTAATTGTTCCTGTGTCTTTCCTTGGTGTGCTAATTAATCTTCTTACAGATTACTGCTAATACT

Reverse complement sequence

AGTATTAGCAGTAATCTGTAAGAAGATTAATTAGCACACCAAGGAAAGACACAGGAACAATTAATAGTACGAGTAGTAGCAAAATATTCGCTTGCATCAA[A/G]
CGATCCAGTAGTTCAACGATTGAAAAGGATACACCGGTGCATAGATGCACGAACGCAAGGTACGCAACGCCAGCCGATTCGATCTGAACCTACTAGAGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	40.80%	0.11%	0.28%	NA
All Indica	2759	92.00%	7.60%	0.07%	0.29%	NA
All Japonica	1512	0.80%	99.00%	0.13%	0.07%	NA
Aus	269	51.70%	48.30%	0.00%	0.00%	NA
Indica I	595	93.10%	6.40%	0.17%	0.34%	NA
Indica II	465	88.20%	11.40%	0.00%	0.43%	NA
Indica III	913	97.00%	2.70%	0.00%	0.22%	NA
Indica Intermediate	786	87.70%	12.00%	0.13%	0.25%	NA
Temperate Japonica	767	0.70%	99.20%	0.13%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.10%	0.41%	0.41%	NA
VI/Aromatic	96	50.00%	49.00%	0.00%	1.04%	NA
Intermediate	90	45.60%	50.00%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724212725	T -> DEL	N	N	silent_mutation	Average:73.192; most accessible tissue: Callus, score: 99.593	N	N	N	N
vg0724212725	T -> C	LOC_Os07g40380.1	3_prime_UTR_variant ; 381.0bp to feature; MODIFIER	silent_mutation	Average:73.192; most accessible tissue: Callus, score: 99.593	N	N	N	N
vg0724212725	T -> C	LOC_Os07g40370.1	upstream_gene_variant ; 4760.0bp to feature; MODIFIER	silent_mutation	Average:73.192; most accessible tissue: Callus, score: 99.593	N	N	N	N
vg0724212725	T -> C	LOC_Os07g40390.1	downstream_gene_variant ; 3153.0bp to feature; MODIFIER	silent_mutation	Average:73.192; most accessible tissue: Callus, score: 99.593	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724212725	NA	9.18E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212725	NA	9.69E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212725	NA	8.09E-27	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212725	NA	5.63E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212725	NA	5.62E-08	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212725	NA	3.25E-08	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212725	NA	2.30E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212725	NA	2.24E-06	mr1181_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212725	NA	3.52E-15	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212725	NA	4.77E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212725	NA	7.27E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251