Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0724212704:

Variant ID: vg0724212704 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24212704
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, C: 0.30, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CCTGGCATCTTCAGGTGTAGGTTCTCTAGTAGGTTCAGATCGAATCGGCTGGCGTTGCGTACCTTGCGTTCGTGCATCTATGCACCGGTGTATCCTTTTC[A/C]
ATCGTTGAACTACTGGATCGTTTGATGCAAGCGAATATTTTGCTACTACTCGTACTATTAATTGTTCCTGTGTCTTTCCTTGGTGTGCTAATTAATCTTC

Reverse complement sequence

GAAGATTAATTAGCACACCAAGGAAAGACACAGGAACAATTAATAGTACGAGTAGTAGCAAAATATTCGCTTGCATCAAACGATCCAGTAGTTCAACGAT[T/G]
GAAAAGGATACACCGGTGCATAGATGCACGAACGCAAGGTACGCAACGCCAGCCGATTCGATCTGAACCTACTAGAGAACCTACACCTGAAGATGCCAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	41.50%	0.11%	0.32%	NA
All Indica	2759	91.90%	7.70%	0.07%	0.33%	NA
All Japonica	1512	0.70%	99.10%	0.07%	0.13%	NA
Aus	269	44.60%	55.40%	0.00%	0.00%	NA
Indica I	595	93.10%	6.40%	0.17%	0.34%	NA
Indica II	465	88.00%	11.60%	0.00%	0.43%	NA
Indica III	913	97.00%	2.70%	0.00%	0.22%	NA
Indica Intermediate	786	87.30%	12.20%	0.13%	0.38%	NA
Temperate Japonica	767	0.70%	99.20%	0.13%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	97.50%	0.00%	0.83%	NA
VI/Aromatic	96	44.80%	54.20%	0.00%	1.04%	NA
Intermediate	90	40.00%	54.40%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724212704	A -> DEL	N	N	silent_mutation	Average:72.927; most accessible tissue: Callus, score: 99.593	N	N	N	N
vg0724212704	A -> C	LOC_Os07g40380.1	3_prime_UTR_variant ; 360.0bp to feature; MODIFIER	silent_mutation	Average:72.927; most accessible tissue: Callus, score: 99.593	N	N	N	N
vg0724212704	A -> C	LOC_Os07g40370.1	upstream_gene_variant ; 4739.0bp to feature; MODIFIER	silent_mutation	Average:72.927; most accessible tissue: Callus, score: 99.593	N	N	N	N
vg0724212704	A -> C	LOC_Os07g40390.1	downstream_gene_variant ; 3174.0bp to feature; MODIFIER	silent_mutation	Average:72.927; most accessible tissue: Callus, score: 99.593	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724212704	NA	6.78E-07	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212704	NA	8.36E-27	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212704	NA	6.36E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212704	NA	1.25E-07	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212704	NA	1.73E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212704	NA	1.63E-32	mr1878	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212704	NA	5.55E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724212704	NA	6.58E-06	mr1181_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251