Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0722859887:

Variant ID: vg0722859887 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 22859887
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTATGCAGGCCAAGCTTCAGCTCATCAAAATTAATCATATTATCTTTGTTGAGATCCATCTTCTCAAACATGTCCTTTATACCAGCAACCTCTTCTAC[T/C]
GAAAGATGCTCAGCTATGACCTGTAGTAAAACAAAATGTGAGAATCCAGAGCAAACAAGACTACTATTGAAAAGCCATAGTTAGGTTTGAGGGTCAGGTC

Reverse complement sequence

GACCTGACCCTCAAACCTAACTATGGCTTTTCAATAGTAGTCTTGTTTGCTCTGGATTCTCACATTTTGTTTTACTACAGGTCATAGCTGAGCATCTTTC[A/G]
GTAGAAGAGGTTGCTGGTATAAAGGACATGTTTGAGAAGATGGATCTCAACAAAGATAATATGATTAATTTTGATGAGCTGAAGCTTGGCCTGCATAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 27.40% 0.15% 0.11% NA
All Indica  2759 96.30% 3.30% 0.22% 0.14% NA
All Japonica  1512 23.20% 76.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 1.50% 0.34% 0.17% NA
Indica II  465 93.50% 5.40% 0.65% 0.43% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 6.40% 0.13% 0.13% NA
Temperate Japonica  767 29.60% 70.40% 0.00% 0.00% NA
Tropical Japonica  504 15.90% 84.10% 0.00% 0.00% NA
Japonica Intermediate  241 18.30% 81.70% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 66.70% 31.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0722859887 T -> DEL LOC_Os07g38120.1 N frameshift_variant Average:79.835; most accessible tissue: Zhenshan97 young leaf, score: 93.371 N N N N
vg0722859887 T -> C LOC_Os07g38120.1 synonymous_variant ; p.Ser374Ser; LOW synonymous_codon Average:79.835; most accessible tissue: Zhenshan97 young leaf, score: 93.371 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0722859887 T C -0.01 -0.01 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0722859887 NA 2.35E-06 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0722859887 NA 2.64E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0722859887 NA 2.34E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251