\
| Variant ID: vg0717004102 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17004102 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCCCATCGCGAAATCCCCGATTCGCCCTAAAAAATCCTCTCCCGCCGCAGCTAATCTCCTCCTCCCGCCACCTATTCGTCCGCTCCACCGATATCCCAAG[A/G]
TTTCCCCAATCAAATCCACGCATGTTAATCATGAACCAAAAGAAATCAAGGTGGGGAAACAAATCAAGAACCCAAAGAAATCAAGGTGGTGCAAACAAAT
ATTTGTTTGCACCACCTTGATTTCTTTGGGTTCTTGATTTGTTTCCCCACCTTGATTTCTTTTGGTTCATGATTAACATGCGTGGATTTGATTGGGGAAA[T/C]
CTTGGGATATCGGTGGAGCGGACGAATAGGTGGCGGGAGGAGGAGATTAGCTGCGGCGGGAGAGGATTTTTTAGGGCGAATCGGGGATTTCGCGATGGGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 3.80% | 0.70% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 0.40% | 0.98% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.10% | 0.40% | 0.00% | NA |
| Aus | 269 | 37.50% | 62.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 1.10% | 3.31% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.00% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717004102 | A -> G | LOC_Os07g28980.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.135; most accessible tissue: Minghui63 flag leaf, score: 79.383 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717004102 | 2.70E-08 | 2.32E-49 | mr1549 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717004102 | 4.22E-09 | 8.60E-58 | mr1550 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717004102 | 6.02E-11 | 1.28E-56 | mr1757 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717004102 | NA | 2.34E-18 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717004102 | 9.68E-06 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717004102 | NA | 8.93E-13 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717004102 | NA | 2.95E-08 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717004102 | 1.56E-08 | 3.14E-47 | mr1549_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717004102 | 9.80E-10 | 2.52E-69 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717004102 | 8.99E-10 | 8.32E-43 | mr1757_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717004102 | NA | 5.73E-07 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |