\
| Variant ID: vg0715863524 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15863524 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGTTTGCCTGTTCGGCAAGAGATATTAGTAATACACACTTAGAGCCTATTTGATTCCCCTATCAAAATTTTACACCGTCACATCAAACGTTTGAACACAT[A/G]
CATAAAGTATTAAATATAAACGAAAAAATATCTAGTTATATAGATTATGTGTAAATTGCAAGATGAATCTTTTAAGCCTAATTGCACCATGATTTATCAA
TTGATAAATCATGGTGCAATTAGGCTTAAAAGATTCATCTTGCAATTTACACATAATCTATATAACTAGATATTTTTTCGTTTATATTTAATACTTTATG[T/C]
ATGTGTTCAAACGTTTGATGTGACGGTGTAAAATTTTGATAGGGGAATCAAATAGGCTCTAAGTGTGTATTACTAATATCTCTTGCCGAACAGGCAAACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.80% | 22.90% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 96.50% | 3.20% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 48.30% | 51.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 25.70% | 71.70% | 2.60% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 91.30% | 8.00% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 27.00% | 73.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715863524 | A -> G | LOC_Os07g27290.1 | downstream_gene_variant ; 553.0bp to feature; MODIFIER | silent_mutation | Average:32.886; most accessible tissue: Callus, score: 48.912 | N | N | N | N |
| vg0715863524 | A -> G | LOC_Os07g27290-LOC_Os07g27300 | intergenic_region ; MODIFIER | silent_mutation | Average:32.886; most accessible tissue: Callus, score: 48.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715863524 | NA | 8.35E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863524 | NA | 3.97E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863524 | NA | 5.29E-10 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863524 | NA | 2.92E-06 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863524 | NA | 1.91E-11 | mr1763 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863524 | NA | 4.99E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863524 | NA | 8.00E-06 | mr1937 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |