\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715704106:

Variant ID: vg0715704106 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15704106
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGGTTGGTGAAGATTCCATATGGCGTACGATGGAGGTATTGTGTGCGTATGGGATGCCGAGTCGAATTTGGAAGGAGTCCAAATTTGGTATGATTGGT[T/C]
ATGTAAAGTTTGTTTCTTGTACAAGAGGGTTTCCTATGGGGATTAGGACTCCTAGTATGAGTTTGGTTCGTGGCTTTAGGCTGCCTACCTCATGTATAAA

Reverse complement sequence

TTTATACATGAGGTAGGCAGCCTAAAGCCACGAACCAAACTCATACTAGGAGTCCTAATCCCCATAGGAAACCCTCTTGTACAAGAAACAAACTTTACAT[A/G]
ACCAATCATACCAAATTTGGACTCCTTCCAAATTCGACTCGGCATCCCATACGCACACAATACCTCCATCGTACGCCATATGGAATCTTCACCAACCACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.40% 20.00% 1.02% 0.57% NA
All Indica  2759 97.10% 2.80% 0.11% 0.04% NA
All Japonica  1512 56.50% 39.20% 2.78% 1.59% NA
Aus  269 37.50% 62.50% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.80% 1.70% 0.43% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 92.60% 7.10% 0.13% 0.13% NA
Temperate Japonica  767 88.40% 10.00% 1.43% 0.13% NA
Tropical Japonica  504 23.20% 68.30% 4.56% 3.97% NA
Japonica Intermediate  241 24.50% 71.00% 3.32% 1.24% NA
VI/Aromatic  96 9.40% 88.50% 1.04% 1.04% NA
Intermediate  90 71.10% 25.60% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715704106 T -> DEL N N silent_mutation Average:42.893; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N
vg0715704106 T -> C LOC_Os07g27090.1 upstream_gene_variant ; 656.0bp to feature; MODIFIER silent_mutation Average:42.893; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N
vg0715704106 T -> C LOC_Os07g27080.1 downstream_gene_variant ; 4066.0bp to feature; MODIFIER silent_mutation Average:42.893; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N
vg0715704106 T -> C LOC_Os07g27080-LOC_Os07g27090 intergenic_region ; MODIFIER silent_mutation Average:42.893; most accessible tissue: Minghui63 young leaf, score: 61.887 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715704106 NA 8.90E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 6.88E-08 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 6.74E-10 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 2.81E-06 mr1590 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 1.92E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 1.31E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 1.17E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 4.81E-12 mr1379_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 2.49E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 3.63E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 2.97E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 3.53E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 2.94E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715704106 NA 9.22E-07 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251