Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0714562076:

Variant ID: vg0714562076 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 14562076
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CACAAAGACTCGGGTTGCTCTAATAGCCAACAAACAGGAGGATGTGCACACCTAGCAAAAGACCTTTTGGGAAACAGGGACTTATTCCAAGTACCTGTCA[C/T]
ATCGGATGTTCGGACACTAATTTGAAGTATTAAACATACACTAATTACAAAACCCATTCCATATCCTTGACTAATTCGCGAGACGAATCTTTTGAGTCTA

Reverse complement sequence

TAGACTCAAAAGATTCGTCTCGCGAATTAGTCAAGGATATGGAATGGGTTTTGTAATTAGTGTATGTTTAATACTTCAAATTAGTGTCCGAACATCCGAT[G/A]
TGACAGGTACTTGGAATAAGTCCCTGTTTCCCAAAAGGTCTTTTGCTAGGTGTGCACATCCTCCTGTTTGTTGGCTATTAGAGCAACCCGAGTCTTTGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 7.60% 0.00% 0.00% NA
All Indica  2759 98.00% 2.00% 0.00% 0.00% NA
All Japonica  1512 79.90% 20.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 93.00% 7.00% 0.00% 0.00% NA
Temperate Japonica  767 65.30% 34.70% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 84.60% 15.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0714562076 C -> T LOC_Os07g25450.1 upstream_gene_variant ; 1185.0bp to feature; MODIFIER silent_mutation Average:51.344; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0714562076 C -> T LOC_Os07g25440-LOC_Os07g25450 intergenic_region ; MODIFIER silent_mutation Average:51.344; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0714562076 NA 6.20E-10 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714562076 NA 4.31E-10 mr1624 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714562076 NA 6.32E-09 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714562076 NA 5.75E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714562076 NA 1.52E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0714562076 NA 1.85E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251