\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710610393:

Variant ID: vg0710610393 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10610393
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCTTTGGTGTCTAGCTCGTGCCTGCCGTCAAGCGCCTGTGGTCGTCGCCCTAGTCTTCCGCTGTTTCCCATTTGTCTTTGTGTGTGCTGGGCCTTCGCT[A/G]
CCCATGTAATAAAGTAACTATTTACGCTTCCGCTTGATAAACTCTGAAATGTATCAACTTTTGGTGTACCTTGCCTCCTGGGACAAGGAATAATACACGC

Reverse complement sequence

GCGTGTATTATTCCTTGTCCCAGGAGGCAAGGTACACCAAAAGTTGATACATTTCAGAGTTTATCAAGCGGAAGCGTAAATAGTTACTTTATTACATGGG[T/C]
AGCGAAGGCCCAGCACACACAAAGACAAATGGGAAACAGCGGAAGACTAGGGCGACGACCACAGGCGCTTGACGGCAGGCACGAGCTAGACACCAAAGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.00% 1.40% 6.24% 57.41% NA
All Indica  2759 5.40% 0.00% 8.26% 86.30% NA
All Japonica  1512 88.10% 4.20% 0.26% 7.47% NA
Aus  269 50.20% 0.40% 13.01% 36.43% NA
Indica I  595 3.20% 0.00% 4.54% 92.27% NA
Indica II  465 6.50% 0.00% 5.59% 87.96% NA
Indica III  913 1.20% 0.00% 12.38% 86.42% NA
Indica Intermediate  786 11.50% 0.00% 7.89% 80.66% NA
Temperate Japonica  767 86.60% 8.20% 0.52% 4.69% NA
Tropical Japonica  504 86.30% 0.00% 0.00% 13.69% NA
Japonica Intermediate  241 96.70% 0.00% 0.00% 3.32% NA
VI/Aromatic  96 2.10% 0.00% 20.83% 77.08% NA
Intermediate  90 38.90% 0.00% 8.89% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710610393 A -> DEL N N silent_mutation Average:10.565; most accessible tissue: Minghui63 young leaf, score: 14.915 N N N N
vg0710610393 A -> G LOC_Os07g17930.1 downstream_gene_variant ; 1849.0bp to feature; MODIFIER silent_mutation Average:10.565; most accessible tissue: Minghui63 young leaf, score: 14.915 N N N N
vg0710610393 A -> G LOC_Os07g17940.1 downstream_gene_variant ; 1134.0bp to feature; MODIFIER silent_mutation Average:10.565; most accessible tissue: Minghui63 young leaf, score: 14.915 N N N N
vg0710610393 A -> G LOC_Os07g17930-LOC_Os07g17940 intergenic_region ; MODIFIER silent_mutation Average:10.565; most accessible tissue: Minghui63 young leaf, score: 14.915 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710610393 NA 1.54E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 1.21E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 1.60E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 3.61E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 1.29E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 9.38E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 2.56E-22 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 4.84E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 5.46E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 4.77E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 2.19E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 7.23E-07 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 3.76E-06 3.76E-06 mr1569_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 6.19E-06 6.19E-06 mr1643_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 5.37E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 1.40E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 1.71E-21 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 1.70E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 1.07E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 1.37E-06 2.11E-06 mr1906_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 6.81E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 3.84E-07 3.75E-08 mr1924_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 1.75E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 5.00E-07 2.59E-08 mr1943_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 5.12E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 6.98E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 1.71E-06 2.56E-06 mr1960_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 2.79E-06 2.79E-06 mr1967_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710610393 NA 1.90E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251