\
| Variant ID: vg0709326055 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9326055 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCTGAGGGTGCGAGGGCCTCCGATAAAGGTGATGCGGGGAACAGGAGTCTCGTCCTCCGAAGGATCAGTGATGTCTGGCTCTATCTCTGGCTCGGTGTCA[G/A]
TCCCCTCCGTCTCGGAGTCGACCTGGATCGGAGTCTCCATGCTAGAACCCAGCTACGGTGACGGGGTAGGGATCAGTGGAGTGTGCACAATCTCTGGGGC
GCCCCAGAGATTGTGCACACTCCACTGATCCCTACCCCGTCACCGTAGCTGGGTTCTAGCATGGAGACTCCGATCCAGGTCGACTCCGAGACGGAGGGGA[C/T]
TGACACCGAGCCAGAGATAGAGCCAGACATCACTGATCCTTCGGAGGACGAGACTCCTGTTCCCCGCATCACCTTTATCGGAGGCCCTCGCACCCTCAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.60% | 6.20% | 17.25% | 44.92% | NA |
| All Indica | 2759 | 4.30% | 0.10% | 24.21% | 71.37% | NA |
| All Japonica | 1512 | 74.80% | 18.50% | 2.38% | 4.37% | NA |
| Aus | 269 | 61.30% | 1.10% | 24.91% | 12.64% | NA |
| Indica I | 595 | 4.50% | 0.20% | 46.55% | 48.74% | NA |
| Indica II | 465 | 6.50% | 0.20% | 14.41% | 78.92% | NA |
| Indica III | 913 | 2.30% | 0.00% | 10.08% | 87.62% | NA |
| Indica Intermediate | 786 | 5.30% | 0.00% | 29.52% | 65.14% | NA |
| Temperate Japonica | 767 | 96.70% | 0.00% | 1.69% | 1.56% | NA |
| Tropical Japonica | 504 | 31.90% | 54.60% | 3.57% | 9.92% | NA |
| Japonica Intermediate | 241 | 94.60% | 1.70% | 2.07% | 1.66% | NA |
| VI/Aromatic | 96 | 52.10% | 0.00% | 28.12% | 19.79% | NA |
| Intermediate | 90 | 31.10% | 11.10% | 18.89% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709326055 | G -> DEL | LOC_Os07g16000.1 | N | frameshift_variant | Average:59.942; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 | N | N | N | N |
| vg0709326055 | G -> A | LOC_Os07g16000.1 | missense_variant ; p.Thr240Ile; MODERATE | nonsynonymous_codon ; T240I | Average:59.942; most accessible tissue: Zhenshan97 flag leaf, score: 78.761 | benign |
0.472 |
TOLERATED | 0.13 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709326055 | NA | 3.89E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709326055 | NA | 1.88E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709326055 | NA | 5.42E-06 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709326055 | NA | 1.62E-06 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709326055 | NA | 5.58E-06 | mr1319_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709326055 | 3.07E-07 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709326055 | 2.47E-06 | NA | mr1745_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709326055 | NA | 2.71E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |