\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706563392:

Variant ID: vg0706563392 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6563392
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATCAGATAATGTCTCCAAATCTTTAGCGCATGAACCACAGCTGCAAGTTCTAGGTCATGGGTAGGGTAGTTTTTCTCATGTGGTCGCAATTGTCGCGA[T/C]
GCATAGGCCACAACCTTTCCGTCCTGCGTCAGTACTCCTCCTAGTCCTTGCCTTGATGCATCACAATATATAACAAAGTCTTTCCTGATGTCAGCAAGAA

Reverse complement sequence

TTCTTGCTGACATCAGGAAAGACTTTGTTATATATTGTGATGCATCAAGGCAAGGACTAGGAGGAGTACTGACGCAGGACGGAAAGGTTGTGGCCTATGC[A/G]
TCGCGACAATTGCGACCACATGAGAAAAACTACCCTACCCATGACCTAGAACTTGCAGCTGTGGTTCATGCGCTAAAGATTTGGAGACATTATCTGATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.90% 13.70% 47.46% 15.98% NA
All Indica  2759 6.70% 2.20% 66.91% 24.25% NA
All Japonica  1512 49.30% 37.60% 12.30% 0.79% NA
Aus  269 13.40% 0.40% 65.06% 21.19% NA
Indica I  595 9.70% 2.70% 61.68% 25.88% NA
Indica II  465 5.80% 5.20% 58.28% 30.75% NA
Indica III  913 3.70% 0.40% 76.56% 19.28% NA
Indica Intermediate  786 8.30% 2.00% 64.76% 24.94% NA
Temperate Japonica  767 24.40% 55.50% 19.04% 1.04% NA
Tropical Japonica  504 85.70% 10.10% 3.57% 0.60% NA
Japonica Intermediate  241 52.30% 38.20% 9.13% 0.41% NA
VI/Aromatic  96 91.70% 3.10% 4.17% 1.04% NA
Intermediate  90 32.20% 14.40% 35.56% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706563392 T -> DEL LOC_Os07g11860.1 N frameshift_variant Average:8.697; most accessible tissue: Callus, score: 11.836 N N N N
vg0706563392 T -> C LOC_Os07g11860.1 synonymous_variant ; p.Ala1019Ala; LOW synonymous_codon Average:8.697; most accessible tissue: Callus, score: 11.836 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706563392 NA 4.61E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 6.85E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 5.08E-06 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 3.49E-07 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 1.75E-06 mr1222 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 4.65E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 4.03E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 3.34E-06 NA mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 8.12E-06 8.12E-06 mr1773 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 7.77E-06 5.87E-08 mr1896 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 2.48E-06 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 4.71E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 7.80E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 2.10E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 3.94E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706563392 NA 1.29E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251