Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706562041:

Variant ID: vg0706562041 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6562041
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, C: 0.03, others allele: 0.00, population size: 30. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTTCCTTTGATCTTGAACCTTTTCGTTCCCCTCATCGGAGAAACCTTTAGATAAACGTAATCTCCTTCCTTAAACTCCAGGTTTCTTCTTCGGGTGTC[C/G]
GCGTAACTCTTCTGTCGTGATTGTGCCACTTTTAGACGGTCTCGAATCAGGTGAACCTTTTCTTCGGCTTCTTTGATAATGTCAGGTCCAAATACCGCCC

Reverse complement sequence

GGGCGGTATTTGGACCTGACATTATCAAAGAAGCCGAAGAAAAGGTTCACCTGATTCGAGACCGTCTAAAAGTGGCACAATCACGACAGAAGAGTTACGC[G/C]
GACACCCGAAGAAGAAACCTGGAGTTTAAGGAAGGAGATTACGTTTATCTAAAGGTTTCTCCGATGAGGGGAACGAAAAGGTTCAAGATCAAAGGAAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.50%	3.50%	29.39%	13.63%	NA
All Indica	2759	29.20%	5.30%	45.16%	20.33%	NA
All Japonica	1512	98.10%	0.40%	0.86%	0.60%	NA
Aus	269	29.70%	4.10%	45.35%	20.82%	NA
Indica I	595	53.80%	5.90%	13.95%	26.39%	NA
Indica II	465	33.50%	3.70%	40.86%	21.94%	NA
Indica III	913	7.20%	6.40%	70.97%	15.44%	NA
Indica Intermediate	786	33.60%	4.60%	41.35%	20.48%	NA
Temperate Japonica	767	97.30%	0.70%	1.17%	0.91%	NA
Tropical Japonica	504	99.40%	0.00%	0.40%	0.20%	NA
Japonica Intermediate	241	98.30%	0.40%	0.83%	0.41%	NA
VI/Aromatic	96	96.90%	1.00%	1.04%	1.04%	NA
Intermediate	90	71.10%	2.20%	7.78%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706562041	C -> DEL	LOC_Os07g11860.1	N	frameshift_variant	Average:10.315; most accessible tissue: Callus, score: 21.511	N	N	N	N
vg0706562041	C -> G	LOC_Os07g11860.1	synonymous_variant ; p.Ala1277Ala; LOW	synonymous_codon	Average:10.315; most accessible tissue: Callus, score: 21.511	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706562041	NA	1.07E-27	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	2.09E-29	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	4.85E-41	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	7.28E-29	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	2.56E-06	mr1748	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	5.73E-55	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	9.93E-55	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	5.62E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	2.72E-59	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	5.28E-35	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	1.71E-33	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	1.36E-36	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	3.44E-43	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	3.32E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	1.37E-28	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	9.69E-40	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	1.25E-18	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	1.69E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	5.37E-26	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	4.19E-18	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	6.05E-23	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	1.09E-18	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	1.36E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	1.24E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	6.73E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	2.92E-32	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	1.77E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	1.88E-24	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	1.81E-19	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562041	NA	7.67E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251