Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704183109:

Variant ID: vg0704183109 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4183109
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCAAACAGATGGTTTTGTCATGGTGTCAACGCTAGATCACATAGAATTTAACAGGTATTTTCTTTCATTGATACAGAAATCTATACATCAATATCAAT[T/C]
CAAGGATATGCAATGACAAAATAATGGCATTAGTTGATGATAGATGAAAAAAAATGTTATTGTACAGTTCACATGTGAAGTGTAACACATTCACATTAGC

Reverse complement sequence

GCTAATGTGAATGTGTTACACTTCACATGTGAACTGTACAATAACATTTTTTTTCATCTATCATCAACTAATGCCATTATTTTGTCATTGCATATCCTTG[A/G]
ATTGATATTGATGTATAGATTTCTGTATCAATGAAAGAAAATACCTGTTAAATTCTATGTGATCTAGCGTTGACACCATGACAAAACCATCTGTTTGGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	99.20%	0.50%	0.30%	0.00%	NA
All Indica	2759	98.70%	0.80%	0.47%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.20%	0.00%	0.84%	0.00%	NA
Indica II	465	99.40%	0.20%	0.43%	0.00%	NA
Indica III	913	97.70%	2.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.10%	0.76%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704183109	T -> C	LOC_Os07g08190.1	downstream_gene_variant ; 1460.0bp to feature; MODIFIER	N	Average:57.792; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0704183109	T -> C	LOC_Os07g08210.1	downstream_gene_variant ; 2096.0bp to feature; MODIFIER	N	Average:57.792; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0704183109	T -> C	LOC_Os07g08210.3	downstream_gene_variant ; 2096.0bp to feature; MODIFIER	N	Average:57.792; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0704183109	T -> C	LOC_Os07g08210.2	downstream_gene_variant ; 2096.0bp to feature; MODIFIER	N	Average:57.792; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0704183109	T -> C	LOC_Os07g08200.1	intron_variant ; MODIFIER	N	Average:57.792; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N