Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703429581:

Variant ID: vg0703429581 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 3429581
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.73, G: 0.27, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTGAAATTGGCAACATTGACTTTAGAACACAGCCCAAGGCATTAACCCACCAACATCCGGGGACACGATCTTGAGTTGAGTTTCCTACTGACGACAAG[T/G]
TAATGCCAACTACAGTACTAATCAGAATCTCCATCTCAGTTACAAGCATGGTGAAGAGTTAATAGAGTTGTCGTGTCTCCCTACCACAAGAACTCAGTGA

Reverse complement sequence

TCACTGAGTTCTTGTGGTAGGGAGACACGACAACTCTATTAACTCTTCACCATGCTTGTAACTGAGATGGAGATTCTGATTAGTACTGTAGTTGGCATTA[A/C]
CTTGTCGTCAGTAGGAAACTCAACTCAAGATCGTGTCCCCGGATGTTGGTGGGTTAATGCCTTGGGCTGTGTTCTAAAGTCAATGTTGCCAATTTCACCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.90%	43.70%	0.19%	0.21%	NA
All Indica	2759	35.90%	63.60%	0.25%	0.29%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	3.30%	96.70%	0.00%	0.00%	NA
Indica I	595	85.00%	14.60%	0.17%	0.17%	NA
Indica II	465	15.10%	84.30%	0.22%	0.43%	NA
Indica III	913	15.90%	83.70%	0.33%	0.11%	NA
Indica Intermediate	786	34.20%	65.00%	0.25%	0.51%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	58.90%	36.70%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0703429581	T -> DEL	N	N	silent_mutation	Average:73.155; most accessible tissue: Callus, score: 89.304	N	N	N	N
vg0703429581	T -> G	LOC_Os07g06970.1	3_prime_UTR_variant ; 94.0bp to feature; MODIFIER	silent_mutation	Average:73.155; most accessible tissue: Callus, score: 89.304	N	N	N	N
vg0703429581	T -> G	LOC_Os07g06960.1	upstream_gene_variant ; 1114.0bp to feature; MODIFIER	silent_mutation	Average:73.155; most accessible tissue: Callus, score: 89.304	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0703429581	NA	3.04E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703429581	NA	3.59E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703429581	NA	1.65E-06	mr1496	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703429581	NA	1.45E-17	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703429581	NA	1.50E-07	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703429581	NA	4.12E-16	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703429581	NA	9.36E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251