\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702899416:

Variant ID: vg0702899416 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2899416
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


CTACAACCCGATGGTGACTCGGTTGTCACGATGGGCTGAGGCAGTAGATGACTACTACGAGGAGGCTCTGTTGGAGATTGACGACCACCAGAGACGTGTG[G/A]
GGGAGTTAGAGACTGAGGTGACCGACCTCACAGCGCAGCAGCTTCAGTTGGAGGAGGAGCACCAGGCTTGGGGCAGTGAGATAGACTCACTGAAGGCACA

Reverse complement sequence

TGTGCCTTCAGTGAGTCTATCTCACTGCCCCAAGCCTGGTGCTCCTCCTCCAACTGAAGCTGCTGCGCTGTGAGGTCGGTCACCTCAGTCTCTAACTCCC[C/T]
CACACGTCTCTGGTGGTCGTCAATCTCCAACAGAGCCTCCTCGTAGTAGTCATCTACTGCCTCAGCCCATCGTGACAACCGAGTCACCATCGGGTTGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 19.70% 8.48% 2.31% NA
All Indica  2759 58.00% 24.90% 13.19% 3.88% NA
All Japonica  1512 86.50% 12.10% 1.39% 0.00% NA
Aus  269 84.80% 12.60% 2.60% 0.00% NA
Indica I  595 56.10% 21.80% 18.99% 3.03% NA
Indica II  465 42.20% 38.10% 14.41% 5.38% NA
Indica III  913 68.90% 16.90% 10.08% 4.16% NA
Indica Intermediate  786 56.10% 28.90% 11.70% 3.31% NA
Temperate Japonica  767 99.10% 0.40% 0.52% 0.00% NA
Tropical Japonica  504 70.20% 27.60% 2.18% 0.00% NA
Japonica Intermediate  241 80.50% 17.00% 2.49% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 65.60% 22.20% 10.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702899416 G -> DEL LOC_Os07g05984.1 N frameshift_variant Average:74.926; most accessible tissue: Zhenshan97 flag leaf, score: 92.451 N N N N
vg0702899416 G -> A LOC_Os07g05984.1 missense_variant ; p.Gly80Arg; MODERATE nonsynonymous_codon ; G80R Average:74.926; most accessible tissue: Zhenshan97 flag leaf, score: 92.451 probably damaging 2.199 TOLERATED 0.16

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0702899416 G A -0.01 -0.01 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702899416 3.35E-06 5.02E-06 mr1745 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702899416 NA 1.00E-05 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702899416 1.04E-06 3.11E-07 mr1745_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251