Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702318720:

Variant ID: vg0702318720 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2318720
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCCACCAAGAAACCAAAAGAAAAACAAACCCCAGATGCAACCAGCAAACAAAACAAAAAACCTACACACAATCTTTATACACTTGCAATCTTGCATCC[T/C]
CCTTACCCAGCAATGAGGCCGGTTGCTCTGACGCATTAAGAACAAGCAACCACACCACCTTGGAGAATGAAGGAAAAGAATGAATGGTTGCGGCGGCAGG

Reverse complement sequence

CCTGCCGCCGCAACCATTCATTCTTTTCCTTCATTCTCCAAGGTGGTGTGGTTGCTTGTTCTTAATGCGTCAGAGCAACCGGCCTCATTGCTGGGTAAGG[A/G]
GGATGCAAGATTGCAAGTGTATAAAGATTGTGTGTAGGTTTTTTGTTTTGTTTGCTGGTTGCATCTGGGGTTTGTTTTTCTTTTGGTTTCTTGGTGGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 42.20% 0.11% 0.00% NA
All Indica  2759 86.40% 13.40% 0.18% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 93.80% 5.90% 0.34% 0.00% NA
Indica II  465 50.10% 49.70% 0.22% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 87.70% 12.10% 0.25% 0.00% NA
Temperate Japonica  767 0.00% 100.00% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 44.40% 55.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702318720 T -> C LOC_Os07g05190.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:69.998; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0702318720 T C 0.02 0.02 0.03 0.01 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702318720 NA 5.87E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702318720 NA 1.83E-10 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702318720 NA 4.80E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702318720 NA 1.05E-12 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702318720 NA 8.55E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702318720 NA 4.12E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702318720 NA 5.20E-10 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702318720 NA 1.87E-10 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702318720 NA 1.25E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702318720 NA 3.80E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702318720 NA 3.29E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702318720 NA 7.41E-19 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251