Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701136340:

Variant ID: vg0701136340 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1136340
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAGGGGAATGAAAAGTGTCAATTTTGTGATAAAAAAGAGGATATACAGCACTTGTTTTTTGAATGCCCTTTGGCCAAACTTCTCTGGAATATCATGTGT[T/A]
GTGCTTTGGATATACTGCCTACTTTGAATCATCAGGATATTTTTGGACATTGGCTGGATAGACATGATAAAAACATGAAACACTTGATTGTGATTGGTTT

Reverse complement sequence

AAACCAATCACAATCAAGTGTTTCATGTTTTTATCATGTCTATCCAGCCAATGTCCAAAAATATCCTGATGATTCAAAGTAGGCAGTATATCCAAAGCAC[A/T]
ACACATGATATTCCAGAGAAGTTTGGCCAAAGGGCATTCAAAAAACAAGTGCTGTATATCCTCTTTTTTATCACAAAATTGACACTTTTCATTCCCCTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.00%	4.00%	0.57%	0.40%	NA
All Indica	2759	99.10%	0.90%	0.04%	0.00%	NA
All Japonica	1512	97.60%	0.00%	1.12%	1.26%	NA
Aus	269	37.50%	59.90%	2.60%	0.00%	NA
Indica I	595	98.70%	1.20%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.70%	0.00%	0.00%	NA
Temperate Japonica	767	99.30%	0.00%	0.13%	0.52%	NA
Tropical Japonica	504	94.00%	0.00%	3.17%	2.78%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	95.60%	2.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701136340	T -> DEL	N	N	silent_mutation	Average:29.077; most accessible tissue: Zhenshan97 flower, score: 57.454	N	N	N	N
vg0701136340	T -> A	LOC_Os07g03020.1	downstream_gene_variant ; 1265.0bp to feature; MODIFIER	silent_mutation	Average:29.077; most accessible tissue: Zhenshan97 flower, score: 57.454	N	N	N	N
vg0701136340	T -> A	LOC_Os07g03025.1	downstream_gene_variant ; 3722.0bp to feature; MODIFIER	silent_mutation	Average:29.077; most accessible tissue: Zhenshan97 flower, score: 57.454	N	N	N	N
vg0701136340	T -> A	LOC_Os07g03020-LOC_Os07g03025	intergenic_region ; MODIFIER	silent_mutation	Average:29.077; most accessible tissue: Zhenshan97 flower, score: 57.454	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701136340	NA	7.04E-06	mr1048	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	2.59E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	2.73E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	3.75E-06	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	9.68E-14	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	4.15E-14	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	1.90E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	3.18E-06	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	8.88E-10	mr1320	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	8.31E-07	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	3.22E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	1.78E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	3.22E-13	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	4.37E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	8.35E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	9.15E-06	mr1438	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	2.63E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	2.22E-08	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	2.54E-41	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	1.53E-06	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	2.42E-13	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	1.58E-36	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	9.01E-11	mr1762	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	5.81E-07	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	9.50E-10	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701136340	NA	5.46E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251