Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700430775:

Variant ID: vg0700430775 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 430775
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

CGATCAAATTCACAGATTAGGCTACAGGATGGTAGGAGTAGTTCCAGCATAATGCATAGGTTGGGAAGCCCTCCAAGGAGCTCTGCCAGCGTGATTCGAA[G/A]
GTTAGGAAGCAGCGCAGGGGTGAATTATGTGAATGGAAATCCCAGAGTTAGATCAGTTGTGAGCATACCCACTAAGGAAGGGCTTGATAGTGGTACATCT

Reverse complement sequence

AGATGTACCACTATCAAGCCCTTCCTTAGTGGGTATGCTCACAACTGATCTAACTCTGGGATTTCCATTCACATAATTCACCCCTGCGCTGCTTCCTAAC[C/T]
TTCGAATCACGCTGGCAGAGCTCCTTGGAGGGCTTCCCAACCTATGCATTATGCTGGAACTACTCCTACCATCCTGTAGCCTAATCTGTGAATTTGATCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.40%	46.30%	0.06%	0.25%	NA
All Indica	2759	21.60%	78.00%	0.11%	0.33%	NA
All Japonica	1512	99.40%	0.50%	0.00%	0.07%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	2.20%	97.60%	0.00%	0.17%	NA
Indica II	465	58.30%	40.90%	0.22%	0.65%	NA
Indica III	913	17.20%	82.60%	0.11%	0.11%	NA
Indica Intermediate	786	19.70%	79.60%	0.13%	0.51%	NA
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	77.80%	20.00%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700430775	G -> DEL	LOC_Os07g01720.1	N	frameshift_variant	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700430775	G -> A	LOC_Os07g01720.1	missense_variant ; p.Arg413Lys; MODERATE	nonsynonymous_codon ; R413K	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	unknown	unknown	TOLERATED	0.57

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0700430775	G	A	-0.09	-0.05	-0.05	-0.05	-0.06	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700430775	NA	9.65E-09	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	8.56E-07	mr1216	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	8.19E-07	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	2.35E-19	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	1.26E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	1.67E-06	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	7.65E-07	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	1.25E-10	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	1.27E-11	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	9.14E-10	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	2.38E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	6.19E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	1.50E-11	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700430775	NA	5.72E-09	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251