Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0631155509:

Variant ID: vg0631155509 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 31155509
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:

TCAGTTCTCCTCAGCTGTGCCTTCTTTTATGACATCTTCTGGGTGTTTGTCTCCAAGAGATGGTTTCATGAGAGCGTGATGATCGTGGTAAGTTTTGTGG[A/G]
AATTTATTCTAGACTTCTGGTAATTGGTGATCTCATTGTTTAAGCTAAGTTGGTTATGCTGGTGTGCTTCTCAAAGGTAGCTCGTGGTGACAAGACTGAT

Reverse complement sequence

ATCAGTCTTGTCACCACGAGCTACCTTTGAGAAGCACACCAGCATAACCAACTTAGCTTAAACAATGAGATCACCAATTACCAGAAGTCTAGAATAAATT[T/C]
CCACAAAACTTACCACGATCATCACGCTCTCATGAAACCATCTCTTGGAGACAAACACCCAGAAGATGTCATAAAAGAAGGCACAGCTGAGGAGAACTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.00%	2.90%	2.14%	0.00%	NA
All Indica	2759	91.40%	5.00%	3.59%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	74.10%	15.30%	10.59%	0.00%	NA
Indica II	465	94.00%	3.20%	2.80%	0.00%	NA
Indica III	913	99.80%	0.00%	0.22%	0.00%	NA
Indica Intermediate	786	93.40%	3.90%	2.67%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0631155509	A -> G	LOC_Os06g51440.1	upstream_gene_variant ; 1820.0bp to feature; MODIFIER	silent_mutation	Average:69.746; most accessible tissue: Callus, score: 85.647	N	N	N	N
vg0631155509	A -> G	LOC_Os06g51420.1	downstream_gene_variant ; 4964.0bp to feature; MODIFIER	silent_mutation	Average:69.746; most accessible tissue: Callus, score: 85.647	N	N	N	N
vg0631155509	A -> G	LOC_Os06g51430.1	intron_variant ; MODIFIER	silent_mutation	Average:69.746; most accessible tissue: Callus, score: 85.647	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0631155509	NA	8.18E-11	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0631155509	4.83E-08	3.30E-17	mr1038	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	4.92E-07	3.70E-16	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	NA	1.11E-06	mr1125	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	1.60E-10	1.13E-22	mr1389	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	1.26E-08	4.49E-19	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	NA	1.85E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	NA	2.99E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	4.57E-11	2.38E-25	mr1038_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	8.30E-10	1.98E-22	mr1038_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	NA	3.29E-07	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	1.12E-06	NA	mr1141_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	6.62E-06	3.67E-09	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	NA	2.48E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	4.63E-09	1.31E-21	mr1389_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	1.65E-07	1.18E-19	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	NA	7.50E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0631155509	NA	2.56E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251