Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0629061313:

Variant ID: vg0629061313 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 29061313
Reference Allele: AGGCACAlternative Allele: A
Primary Allele: AGGCACSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACAGGAATCACACCAAATATCAAGAAACTGTAGCAGCCAATAGAATACAGTATATTGCAAATATATGATATTTAGTAAATTTCATCCCAAACAAAATGT[AGGCAC/A]
AGTATGACAACTCAGACAAGTATGTTACAAGTTTCTGGAAAACAACCTCAGCGATGCCTTCCATGTTTATACGCCTGTAGTTCTCTCTCTCCACCAGCAA

Reverse complement sequence

TTGCTGGTGGAGAGAGAGAACTACAGGCGTATAAACATGGAAGGCATCGCTGAGGTTGTTTTCCAGAAACTTGTAACATACTTGTCTGAGTTGTCATACT[GTGCCT/T]
ACATTTTGTTTGGGATGAAATTTACTAAATATCATATATTTGCAATATACTGTATTCTATTGGCTGCTACAGTTTCTTGATATTTGGTGTGATTCCTGTT

Allele Frequencies:

Populations Population SizeFrequency of AGGCAC(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.80% 21.60% 0.23% 0.38% NA
All Indica  2759 70.10% 29.00% 0.36% 0.58% NA
All Japonica  1512 97.90% 2.00% 0.00% 0.07% NA
Aus  269 69.50% 30.50% 0.00% 0.00% NA
Indica I  595 52.80% 45.90% 0.17% 1.18% NA
Indica II  465 64.50% 34.20% 0.86% 0.43% NA
Indica III  913 84.80% 14.60% 0.22% 0.44% NA
Indica Intermediate  786 69.50% 29.80% 0.38% 0.38% NA
Temperate Japonica  767 98.00% 2.00% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.00% 0.41% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0629061313 AGGCAC -> A LOC_Os06g48040.1 intron_variant ; MODIFIER silent_mutation Average:70.047; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg0629061313 AGGCAC -> DEL N N silent_mutation Average:70.047; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0629061313 AGGCA* A 0.02 0.0 -0.09 -0.02 -0.03 0.0