\
| Variant ID: vg0627798787 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 27798787 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATCAATTTGATATCATTTACTAAAAGTTGTCTATAACATAATTCATGTACTCTGTCGGGAGACTCTGGACAACTTCTCTTCTTTTCTTTTTTTACATTT[T/A]
AAAAAAATCATATTTAAACCGTGTTTCAAATACATTCTTTTTTTTTTCGGAATTTCTTCCAATCGGGCGTTGGGTGGGTTGGGGGGGGGAGGCGCCCCCC
GGGGGGCGCCTCCCCCCCCCAACCCACCCAACGCCCGATTGGAAGAAATTCCGAAAAAAAAAAGAATGTATTTGAAACACGGTTTAAATATGATTTTTTT[A/T]
AAATGTAAAAAAAGAAAAGAAGAGAAGTTGTCCAGAGTCTCCCGACAGAGTACATGAATTATGTTATAGACAACTTTTAGTAAATGATATCAAATTGATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.40% | 11.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 87.60% | 12.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 29.70% | 69.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.70% | 16.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.70% | 19.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0627798787 | T -> A | LOC_Os06g45920.1 | upstream_gene_variant ; 2121.0bp to feature; MODIFIER | silent_mutation | Average:77.578; most accessible tissue: Callus, score: 94.03 | N | N | N | N |
| vg0627798787 | T -> A | LOC_Os06g45910.1 | downstream_gene_variant ; 207.0bp to feature; MODIFIER | silent_mutation | Average:77.578; most accessible tissue: Callus, score: 94.03 | N | N | N | N |
| vg0627798787 | T -> A | LOC_Os06g45910-LOC_Os06g45920 | intergenic_region ; MODIFIER | silent_mutation | Average:77.578; most accessible tissue: Callus, score: 94.03 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0627798787 | NA | 7.86E-07 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627798787 | NA | 5.46E-06 | mr1182_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627798787 | 1.98E-06 | 1.98E-06 | mr1282_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627798787 | NA | 2.07E-09 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627798787 | NA | 2.25E-06 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0627798787 | NA | 6.51E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |