\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627798787:

Variant ID: vg0627798787 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 27798787
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCAATTTGATATCATTTACTAAAAGTTGTCTATAACATAATTCATGTACTCTGTCGGGAGACTCTGGACAACTTCTCTTCTTTTCTTTTTTTACATTT[T/A]
AAAAAAATCATATTTAAACCGTGTTTCAAATACATTCTTTTTTTTTTCGGAATTTCTTCCAATCGGGCGTTGGGTGGGTTGGGGGGGGGAGGCGCCCCCC

Reverse complement sequence

GGGGGGCGCCTCCCCCCCCCAACCCACCCAACGCCCGATTGGAAGAAATTCCGAAAAAAAAAAGAATGTATTTGAAACACGGTTTAAATATGATTTTTTT[A/T]
AAATGTAAAAAAAGAAAAGAAGAGAAGTTGTCCAGAGTCTCCCGACAGAGTACATGAATTATGTTATAGACAACTTTTAGTAAATGATATCAAATTGATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 11.50% 0.04% 0.00% NA
All Indica  2759 87.60% 12.30% 0.04% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 29.70% 69.90% 0.37% 0.00% NA
Indica I  595 95.00% 5.00% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 83.70% 16.30% 0.00% 0.00% NA
Indica Intermediate  786 80.70% 19.20% 0.13% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0627798787 T -> A LOC_Os06g45920.1 upstream_gene_variant ; 2121.0bp to feature; MODIFIER silent_mutation Average:77.578; most accessible tissue: Callus, score: 94.03 N N N N
vg0627798787 T -> A LOC_Os06g45910.1 downstream_gene_variant ; 207.0bp to feature; MODIFIER silent_mutation Average:77.578; most accessible tissue: Callus, score: 94.03 N N N N
vg0627798787 T -> A LOC_Os06g45910-LOC_Os06g45920 intergenic_region ; MODIFIER silent_mutation Average:77.578; most accessible tissue: Callus, score: 94.03 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0627798787 NA 7.86E-07 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627798787 NA 5.46E-06 mr1182_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627798787 1.98E-06 1.98E-06 mr1282_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627798787 NA 2.07E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627798787 NA 2.25E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627798787 NA 6.51E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251