\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0626873273:

Variant ID: vg0626873273 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 26873273
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, A: 0.29, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCTCATAAGGATTGCATATACATATAAGTTGGATTTAGCCGATGGCAACAAAGGTTTCACTGTTTTAATCTAATCTTATGGATTTCATGACATCGGAC[C/A]
TCCAGCCGATGTGTGCTTTAACCTTCGGATCGATGCTTATTTATCATATCATTATTTGCCGATTGGTTTCTACTGGACTATATTATTGTTATATTTTATT

Reverse complement sequence

AATAAAATATAACAATAATATAGTCCAGTAGAAACCAATCGGCAAATAATGATATGATAAATAAGCATCGATCCGAAGGTTAAAGCACACATCGGCTGGA[G/T]
GTCCGATGTCATGAAATCCATAAGATTAGATTAAAACAGTGAAACCTTTGTTGCCATCGGCTAAATCCAACTTATATGTATATGCAATCCTTATGAGCCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 43.50% 0.04% 0.00% NA
All Indica  2759 90.00% 10.00% 0.04% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 51.70% 48.30% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 82.30% 17.70% 0.00% 0.00% NA
Indica Intermediate  786 89.40% 10.40% 0.13% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 92.70% 1.04% 0.00% NA
Intermediate  90 33.30% 66.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0626873273 C -> A LOC_Os06g44480.1 upstream_gene_variant ; 3379.0bp to feature; MODIFIER silent_mutation Average:55.174; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg0626873273 C -> A LOC_Os06g44490.1 upstream_gene_variant ; 1242.0bp to feature; MODIFIER silent_mutation Average:55.174; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg0626873273 C -> A LOC_Os06g44500.1 downstream_gene_variant ; 3722.0bp to feature; MODIFIER silent_mutation Average:55.174; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N
vg0626873273 C -> A LOC_Os06g44490-LOC_Os06g44500 intergenic_region ; MODIFIER silent_mutation Average:55.174; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0626873273 NA 2.04E-38 mr1064 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626873273 NA 6.67E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626873273 NA 2.91E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626873273 NA 4.75E-42 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626873273 NA 4.71E-06 mr1805 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0626873273 NA 9.31E-59 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251