\
| Variant ID: vg0626873273 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 26873273 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.71, A: 0.29, others allele: 0.00, population size: 227. )
CGGCTCATAAGGATTGCATATACATATAAGTTGGATTTAGCCGATGGCAACAAAGGTTTCACTGTTTTAATCTAATCTTATGGATTTCATGACATCGGAC[C/A]
TCCAGCCGATGTGTGCTTTAACCTTCGGATCGATGCTTATTTATCATATCATTATTTGCCGATTGGTTTCTACTGGACTATATTATTGTTATATTTTATT
AATAAAATATAACAATAATATAGTCCAGTAGAAACCAATCGGCAAATAATGATATGATAAATAAGCATCGATCCGAAGGTTAAAGCACACATCGGCTGGA[G/T]
GTCCGATGTCATGAAATCCATAAGATTAGATTAAAACAGTGAAACCTTTGTTGCCATCGGCTAAATCCAACTTATATGTATATGCAATCCTTATGAGCCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.50% | 43.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 90.00% | 10.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 51.70% | 48.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.40% | 10.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 92.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 66.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0626873273 | C -> A | LOC_Os06g44480.1 | upstream_gene_variant ; 3379.0bp to feature; MODIFIER | silent_mutation | Average:55.174; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0626873273 | C -> A | LOC_Os06g44490.1 | upstream_gene_variant ; 1242.0bp to feature; MODIFIER | silent_mutation | Average:55.174; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0626873273 | C -> A | LOC_Os06g44500.1 | downstream_gene_variant ; 3722.0bp to feature; MODIFIER | silent_mutation | Average:55.174; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0626873273 | C -> A | LOC_Os06g44490-LOC_Os06g44500 | intergenic_region ; MODIFIER | silent_mutation | Average:55.174; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0626873273 | NA | 2.04E-38 | mr1064 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626873273 | NA | 6.67E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626873273 | NA | 2.91E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626873273 | NA | 4.75E-42 | mr1534 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626873273 | NA | 4.71E-06 | mr1805 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0626873273 | NA | 9.31E-59 | mr1064_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |