\
| Variant ID: vg0624062700 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr06 | Position: 24062700 |
| Reference Allele: TGTA | Alternative Allele: CGTA,T |
| Primary Allele: TGTA | Secondary Allele: CGTA |
Inferred Ancestral Allele: Not determined.
CTTCGCTCTCTATAGGCTGGCTACCAGGCCCCTTTCCAAACACTACTTTAAGATCTTTAACCATAGCAAACACTGTTTTCCCGCTGCGATGTTTAGGCTT[TGTA/CGTA,T]
CAGTGGTCCTCCTTATGTTCAAAGTGCTTGCCTTTCTTCCGTACCGGGTGGTTTGCTGCAAGGAATCGACGATAACCCATGTACACAACCTTCCTACAGT
ACTGTAGGAAGGTTGTGTACATGGGTTATCGTCGATTCCTTGCAGCAAACCACCCGGTACGGAAGAAAGGCAAGCACTTTGAACATAAGGAGGACCACTG[TACA/TACG,A]
AAGCCTAAACATCGCAGCGGGAAAACAGTGTTTGCTATGGTTAAAGATCTTAAAGTAGTGTTTGGAAAGGGGCCTGGTAGCCAGCCTATAGAGAGCGAAG
| Populations | Population Size | Frequency of TGTA(primary allele) | Frequency of CGTA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.40% | 0.20% | 19.85% | 37.60% | NA |
| All Indica | 2759 | 16.20% | 0.30% | 21.35% | 62.16% | NA |
| All Japonica | 1512 | 89.20% | 0.10% | 8.80% | 1.92% | NA |
| Aus | 269 | 26.40% | 0.00% | 71.00% | 2.60% | NA |
| Indica I | 595 | 4.50% | 0.20% | 6.05% | 89.24% | NA |
| Indica II | 465 | 11.80% | 0.20% | 19.78% | 68.17% | NA |
| Indica III | 913 | 28.30% | 0.00% | 29.90% | 41.84% | NA |
| Indica Intermediate | 786 | 13.60% | 0.80% | 23.92% | 61.70% | NA |
| Temperate Japonica | 767 | 96.70% | 0.00% | 1.56% | 1.69% | NA |
| Tropical Japonica | 504 | 74.60% | 0.20% | 22.42% | 2.78% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.00% | 3.32% | 0.83% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 16.67% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 0.00% | 10.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0624062700 | TGTA -> CGTA | LOC_Os06g40410.1 | synonymous_variant ; p.Thr532Thr; LOW | synonymous_codon | Average:21.175; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0624062700 | TGTA -> T | LOC_Os06g40410.1 | stop_gained&disruptive_inframe_deletion ; p.Cys531_Thr532delinsTer; HIGH | N | Average:21.175; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0624062700 | TGTA -> DEL | LOC_Os06g40410.1 | N | frameshift_variant | Average:21.175; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0624062700 | NA | 8.45E-09 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 1.97E-07 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 1.22E-07 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 7.26E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 1.91E-08 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 2.85E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 1.32E-07 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 1.57E-08 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 2.24E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 8.48E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 3.85E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 5.95E-07 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | 3.01E-08 | 6.55E-12 | mr1807_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0624062700 | NA | 8.15E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |