Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622846135:

Variant ID: vg0622846135 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 22846135
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATGTCAGCCTCACTCTCCATTCAAACAAAAGTGATGCGGGACCCGATGATGAGTGAGGCTGACATGTGGGCCCGGGTGGCATCTGGGAATGAAAATTT[G/A]
GGAGAGTGGCATTTAAGCACTGGCATTTTGAGAGAGTGGCAAATAGTAAATTCCCCCGCTAGCGGCATCACTCACAAGATCAAGGAATCAAGGTTAGCTG

Reverse complement sequence

CAGCTAACCTTGATTCCTTGATCTTGTGAGTGATGCCGCTAGCGGGGGAATTTACTATTTGCCACTCTCTCAAAATGCCAGTGCTTAAATGCCACTCTCC[C/T]
AAATTTTCATTCCCAGATGCCACCCGGGCCCACATGTCAGCCTCACTCATCATCGGGTCCCGCATCACTTTTGTTTGAATGGAGAGTGAGGCTGACATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 1.80% 4.25% 7.83% NA
All Indica  2759 91.80% 3.00% 3.77% 1.38% NA
All Japonica  1512 84.20% 0.10% 2.18% 13.56% NA
Aus  269 48.00% 0.00% 9.67% 42.38% NA
Indica I  595 75.50% 10.40% 14.12% 0.00% NA
Indica II  465 97.00% 0.20% 0.43% 2.37% NA
Indica III  913 97.90% 0.10% 0.44% 1.53% NA
Indica Intermediate  786 94.10% 2.40% 1.78% 1.65% NA
Temperate Japonica  767 82.00% 0.00% 1.83% 16.17% NA
Tropical Japonica  504 89.90% 0.00% 2.98% 7.14% NA
Japonica Intermediate  241 79.30% 0.40% 1.66% 18.67% NA
VI/Aromatic  96 57.30% 1.00% 34.38% 7.29% NA
Intermediate  90 85.60% 2.20% 5.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622846135 G -> A LOC_Os06g38564.1 downstream_gene_variant ; 4451.0bp to feature; MODIFIER silent_mutation Average:57.71; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0622846135 G -> A LOC_Os06g38564-LOC_Os06g38580 intergenic_region ; MODIFIER silent_mutation Average:57.71; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0622846135 G -> DEL N N silent_mutation Average:57.71; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0622846135 G A 0.01 0.01 0.01 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622846135 2.46E-08 7.45E-13 mr1038 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622846135 4.04E-06 1.02E-09 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622846135 7.81E-10 7.82E-17 mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622846135 3.50E-07 1.12E-11 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622846135 1.09E-08 4.58E-16 mr1038_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622846135 4.19E-06 2.34E-11 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622846135 2.24E-06 1.41E-13 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622846135 NA 1.16E-10 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251