Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622804797:

Variant ID: vg0622804797 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 22804797
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, A: 0.39, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGCGGGAAGCGTGGGCGTCGTCGTGGTCGCGCCATCGCCATCGACCTTAACAATCTCGGGCTGGCTGGTAGCATCTCCCCTTCCATTTCTAATCTTAC[G/A]
TACCTCAGGAAGCTCCACTTGCCACAGAACCAGTTTGGTGGGCACATCCCACATGAACTCGGCCTTCTCGACGATCTTAAGTTTCTGAACTTTGTGAATT

Reverse complement sequence

AATTCACAAAGTTCAGAAACTTAAGATCGTCGAGAAGGCCGAGTTCATGTGGGATGTGCCCACCAAACTGGTTCTGTGGCAAGTGGAGCTTCCTGAGGTA[C/T]
GTAAGATTAGAAATGGAAGGGGAGATGCTACCAGCCAGCCCGAGATTGTTAAGGTCGATGGCGATGGCGCGACCACGACGACGCCCACGCTTCCCGCACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.10%	40.60%	0.23%	0.00%	NA
All Indica	2759	77.30%	22.30%	0.36%	0.00%	NA
All Japonica	1512	17.00%	83.00%	0.00%	0.00%	NA
Aus	269	95.90%	4.10%	0.00%	0.00%	NA
Indica I	595	85.70%	14.30%	0.00%	0.00%	NA
Indica II	465	83.90%	15.90%	0.22%	0.00%	NA
Indica III	913	71.30%	28.10%	0.55%	0.00%	NA
Indica Intermediate	786	74.20%	25.30%	0.51%	0.00%	NA
Temperate Japonica	767	9.40%	90.60%	0.00%	0.00%	NA
Tropical Japonica	504	29.60%	70.40%	0.00%	0.00%	NA
Japonica Intermediate	241	14.90%	85.10%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622804797	G -> A	LOC_Os06g38470.1	upstream_gene_variant ; 4576.0bp to feature; MODIFIER	silent_mutation	Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0622804797	G -> A	LOC_Os06g38490.1	upstream_gene_variant ; 4854.0bp to feature; MODIFIER	silent_mutation	Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0622804797	G -> A	LOC_Os06g38470.3	upstream_gene_variant ; 4601.0bp to feature; MODIFIER	silent_mutation	Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0622804797	G -> A	LOC_Os06g38470.2	upstream_gene_variant ; 4576.0bp to feature; MODIFIER	silent_mutation	Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0622804797	G -> A	LOC_Os06g38480.1	downstream_gene_variant ; 2727.0bp to feature; MODIFIER	silent_mutation	Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0622804797	G -> A	LOC_Os06g38480.2	downstream_gene_variant ; 2727.0bp to feature; MODIFIER	silent_mutation	Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0622804797	G -> A	LOC_Os06g38470-LOC_Os06g38480	intergenic_region ; MODIFIER	silent_mutation	Average:67.435; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622804797	NA	3.80E-07	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797	NA	4.71E-07	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797	NA	4.79E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797	NA	1.92E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797	NA	2.21E-06	mr1746	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797	4.44E-06	NA	mr1846	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622804797	NA	2.87E-07	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251