\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622627045:

Variant ID: vg0622627045 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 22627045
Reference Allele: ATAlternative Allele: GT,A
Primary Allele: ATSecondary Allele: GT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAGTTCTTTATTATCTATTTTCCATTGCCGATCGATCTATATATGACATCGGCTCAAACGTAAATGATATGTCATCGGCACCTGGCCGATCGGCTATC[AT/GT,A]
TTATAGATTTAACCACGGTTCTTTTGTCTCTGTTTCTTGTTGATTGTAGGATCAAATCAACTGGCACGCTCACGTATCCGAAGGCGAGTTTTGGACCTGC

Reverse complement sequence

GCAGGTCCAAAACTCGCCTTCGGATACGTGAGCGTGCCAGTTGATTTGATCCTACAATCAACAAGAAACAGAGACAAAAGAACCGTGGTTAAATCTATAA[AT/AC,T]
GATAGCCGATCGGCCAGGTGCCGATGACATATCATTTACGTTTGAGCCGATGTCATATATAGATCGATCGGCAATGGAAAATAGATAATAAAGAACTAAA

Allele Frequencies:

Populations Population SizeFrequency of AT(primary allele) Frequency of GT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 4.80% 2.92% 0.19% A: 0.04%
All Indica  2759 96.80% 1.10% 1.92% 0.04% A: 0.07%
All Japonica  1512 96.10% 0.40% 2.98% 0.53% NA
Aus  269 19.30% 68.80% 11.90% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 0.20% 1.94% 0.00% NA
Indica III  913 95.30% 1.50% 2.85% 0.11% A: 0.22%
Indica Intermediate  786 95.70% 2.00% 2.29% 0.00% NA
Temperate Japonica  767 96.90% 0.30% 2.61% 0.26% NA
Tropical Japonica  504 95.20% 0.20% 3.77% 0.79% NA
Japonica Intermediate  241 95.40% 1.20% 2.49% 0.83% NA
VI/Aromatic  96 93.80% 2.10% 4.17% 0.00% NA
Intermediate  90 94.40% 1.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0622627045 AT -> A LOC_Os06g38230.1 upstream_gene_variant ; 1444.0bp to feature; MODIFIER silent_mutation Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809 N N N N
vg0622627045 AT -> A LOC_Os06g38240.1 upstream_gene_variant ; 344.0bp to feature; MODIFIER silent_mutation Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809 N N N N
vg0622627045 AT -> A LOC_Os06g38230-LOC_Os06g38240 intergenic_region ; MODIFIER silent_mutation Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809 N N N N
vg0622627045 AT -> DEL N N silent_mutation Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809 N N N N
vg0622627045 AT -> GT LOC_Os06g38230.1 upstream_gene_variant ; 1443.0bp to feature; MODIFIER silent_mutation Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809 N N N N
vg0622627045 AT -> GT LOC_Os06g38240.1 upstream_gene_variant ; 345.0bp to feature; MODIFIER silent_mutation Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809 N N N N
vg0622627045 AT -> GT LOC_Os06g38230-LOC_Os06g38240 intergenic_region ; MODIFIER silent_mutation Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0622627045 NA 8.50E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 NA 4.07E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 2.77E-08 1.47E-50 mr1549 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 6.28E-09 4.09E-56 mr1550 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 NA 9.17E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 NA 1.67E-07 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 NA 2.78E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 NA 7.83E-07 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 6.83E-09 1.06E-54 mr1757 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 NA 2.20E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 NA 2.18E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 NA 5.93E-08 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 NA 2.96E-10 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 1.15E-07 4.51E-44 mr1549_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 2.33E-07 2.58E-58 mr1550_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045 1.58E-07 7.89E-41 mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251