Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0622627045:

Variant ID: vg0622627045 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 22627045
Reference Allele: AT	Alternative Allele: GT,A
Primary Allele: AT	Secondary Allele: GT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAGTTCTTTATTATCTATTTTCCATTGCCGATCGATCTATATATGACATCGGCTCAAACGTAAATGATATGTCATCGGCACCTGGCCGATCGGCTATC[AT/GT,A]
TTATAGATTTAACCACGGTTCTTTTGTCTCTGTTTCTTGTTGATTGTAGGATCAAATCAACTGGCACGCTCACGTATCCGAAGGCGAGTTTTGGACCTGC

Reverse complement sequence

GCAGGTCCAAAACTCGCCTTCGGATACGTGAGCGTGCCAGTTGATTTGATCCTACAATCAACAAGAAACAGAGACAAAAGAACCGTGGTTAAATCTATAA[AT/AC,T]
GATAGCCGATCGGCCAGGTGCCGATGACATATCATTTACGTTTGAGCCGATGTCATATATAGATCGATCGGCAATGGAAAATAGATAATAAAGAACTAAA

Allele Frequencies:

Populations	Population Size	Frequency of AT(primary allele)	Frequency of GT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.10%	4.80%	2.92%	0.19%	A: 0.04%
All Indica	2759	96.80%	1.10%	1.92%	0.04%	A: 0.07%
All Japonica	1512	96.10%	0.40%	2.98%	0.53%	NA
Aus	269	19.30%	68.80%	11.90%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.80%	0.20%	1.94%	0.00%	NA
Indica III	913	95.30%	1.50%	2.85%	0.11%	A: 0.22%
Indica Intermediate	786	95.70%	2.00%	2.29%	0.00%	NA
Temperate Japonica	767	96.90%	0.30%	2.61%	0.26%	NA
Tropical Japonica	504	95.20%	0.20%	3.77%	0.79%	NA
Japonica Intermediate	241	95.40%	1.20%	2.49%	0.83%	NA
VI/Aromatic	96	93.80%	2.10%	4.17%	0.00%	NA
Intermediate	90	94.40%	1.10%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0622627045	AT -> A	LOC_Os06g38230.1	upstream_gene_variant ; 1444.0bp to feature; MODIFIER	silent_mutation	Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	N	N	N	N
vg0622627045	AT -> A	LOC_Os06g38240.1	upstream_gene_variant ; 344.0bp to feature; MODIFIER	silent_mutation	Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	N	N	N	N
vg0622627045	AT -> A	LOC_Os06g38230-LOC_Os06g38240	intergenic_region ; MODIFIER	silent_mutation	Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	N	N	N	N
vg0622627045	AT -> DEL	N	N	silent_mutation	Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	N	N	N	N
vg0622627045	AT -> GT	LOC_Os06g38230.1	upstream_gene_variant ; 1443.0bp to feature; MODIFIER	silent_mutation	Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	N	N	N	N
vg0622627045	AT -> GT	LOC_Os06g38240.1	upstream_gene_variant ; 345.0bp to feature; MODIFIER	silent_mutation	Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	N	N	N	N
vg0622627045	AT -> GT	LOC_Os06g38230-LOC_Os06g38240	intergenic_region ; MODIFIER	silent_mutation	Average:13.253; most accessible tissue: Zhenshan97 flag leaf, score: 25.809	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0622627045	NA	8.50E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	NA	4.07E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	2.77E-08	1.47E-50	mr1549	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	6.28E-09	4.09E-56	mr1550	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	NA	9.17E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	NA	1.67E-07	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	NA	2.78E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	NA	7.83E-07	mr1738	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	6.83E-09	1.06E-54	mr1757	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	NA	2.20E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	NA	2.18E-10	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	NA	5.93E-08	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	NA	2.96E-10	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	1.15E-07	4.51E-44	mr1549_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	2.33E-07	2.58E-58	mr1550_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0622627045	1.58E-07	7.89E-41	mr1757_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251