\
| Variant ID: vg0621414627 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 21414627 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
ATCACAGAAGAATATGGAAACATTTATTCCCTCCTCATGCATGCCACTGAGGAGTTTTTGGAACCAATTAAAGATATTCCTTAGGAAAAAGGAAGATTTT[G/T]
GAACTAAAGCTAGCCATGCATACCTAGAAATCTTTAGAGTTTCCTTGTTCATGGAATATTTCTTGGCAAATGTGTATCTTGAGAAACTATAAAAAATTCA
TGAATTTTTTATAGTTTCTCAAGATACACATTTGCCAAGAAATATTCCATGAACAAGGAAACTCTAAAGATTTCTAGGTATGCATGGCTAGCTTTAGTTC[C/A]
AAAATCTTCCTTTTTCCTAAGGAATATCTTTAATTGGTTCCAAAAACTCCTCAGTGGCATGCATGAGGAGGGAATAAATGTTTCCATATTCTTCTGTGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.30% | 1.20% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 94.70% | 3.80% | 1.52% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.30% | 2.20% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 1.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.00% | 12.90% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0621414627 | G -> T | LOC_Os06g36470.1 | downstream_gene_variant ; 4304.0bp to feature; MODIFIER | silent_mutation | Average:47.301; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg0621414627 | G -> T | LOC_Os06g36480.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.301; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0621414627 | NA | 4.22E-07 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621414627 | 7.77E-07 | NA | mr1549 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621414627 | 3.22E-08 | 1.12E-07 | mr1550 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621414627 | 1.16E-06 | 6.15E-07 | mr1745 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621414627 | 2.08E-07 | 3.77E-08 | mr1757 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0621414627 | NA | 5.19E-06 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |