\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620348476:

Variant ID: vg0620348476 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20348476
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCTTGGTCCAGATTCACTAATTTAGTGCAGTTCGGACCAACCCTGTCCTTACCTGTGTATGTGCTTCTCCAACATTTCCATACGGGTTTGGATAAGGA[A/G]
TCTGCATTCTATCTGGACATAACCGCTGGAGGATCGTTCATGCATAAAACGCCGTCAGAAGGAAAAACGATCTTGGATCGTATTCTAGAAAGGCAAAATT

Reverse complement sequence

AATTTTGCCTTTCTAGAATACGATCCAAGATCGTTTTTCCTTCTGACGGCGTTTTATGCATGAACGATCCTCCAGCGGTTATGTCCAGATAGAATGCAGA[T/C]
TCCTTATCCAAACCCGTATGGAAATGTTGGAGAAGCACATACACAGGTAAGGACAGGGTTGGTCCGAACTGCACTAAATTAGTGAATCTGGACCAAGCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.10% 1.30% 1.93% 60.66% NA
All Indica  2759 7.60% 2.10% 2.72% 87.64% NA
All Japonica  1512 92.80% 0.00% 0.26% 6.94% NA
Aus  269 4.80% 0.40% 4.09% 90.71% NA
Indica I  595 12.60% 0.00% 1.34% 86.05% NA
Indica II  465 7.70% 0.90% 2.58% 88.82% NA
Indica III  913 2.30% 4.80% 3.29% 89.59% NA
Indica Intermediate  786 9.80% 1.10% 3.18% 85.88% NA
Temperate Japonica  767 93.70% 0.00% 0.13% 6.13% NA
Tropical Japonica  504 93.50% 0.00% 0.40% 6.15% NA
Japonica Intermediate  241 88.40% 0.00% 0.41% 11.20% NA
VI/Aromatic  96 35.40% 2.10% 1.04% 61.46% NA
Intermediate  90 54.40% 0.00% 0.00% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620348476 A -> G LOC_Os06g34980.1 synonymous_variant ; p.Glu166Glu; LOW synonymous_codon Average:13.821; most accessible tissue: Callus, score: 40.894 N N N N
vg0620348476 A -> DEL LOC_Os06g34980.1 N frameshift_variant Average:13.821; most accessible tissue: Callus, score: 40.894 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0620348476 3.48E-06 3.48E-06 mr1046 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 1.67E-06 NA mr1166 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 3.28E-06 8.30E-07 mr1166 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 NA 8.99E-06 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 6.62E-07 6.62E-07 mr1379 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 9.33E-06 9.33E-06 mr1387 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 NA 2.91E-06 mr1397 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 NA 1.80E-06 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 3.33E-06 1.72E-06 mr1433 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 7.45E-07 2.29E-08 mr1434 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 4.22E-06 1.18E-06 mr1434 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 4.39E-06 4.39E-06 mr1501 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 NA 1.40E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 NA 7.77E-06 mr1600 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 NA 8.62E-06 mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 NA 3.47E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 7.22E-06 5.87E-06 mr1704 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 4.64E-06 4.64E-06 mr1724 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 3.06E-06 2.16E-06 mr1738 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 6.35E-08 6.35E-08 mr1738 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 4.19E-06 4.19E-06 mr1748 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 5.55E-07 1.42E-06 mr1851 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620348476 1.42E-07 8.70E-06 mr1851 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251